CLDN15-claudin 15 Gene View larger

CLDN15-claudin 15 Gene

PTXBC010160

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLDN15-claudin 15 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLDN15-claudin 15 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010160
Product type: DNA & cDNA
Ncbi symbol: CLDN15
Origin species: Human
Product name: CLDN15-claudin 15 Gene
Size: 2ug
Accessions: BC010160
Gene id: 24146
Gene description: claudin 15
Synonyms: claudin-15; claudin 15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgatggctgtggaaacctttggcttcttcatggcaactgtggggctgctgatgctgggggtgactctgccaaacagctactggcgagtgtccactgtgcacgggaacgtcatcaccaccaacaccatcttcgagaacctctggtttagctgtgccaccgactccctgggcgtctacaactgctgggagttcccgtccatgctggccctctctggctccacagactccccagcctcactgtcggggggcactggtctccttgtccggctgatgtctataaagggcccctgtgaagggaggcgtcttgcaagttgcaggttgagcgtccgctgtaaggaggcggtgtgtgtgcagggtatattcaggcctgccgggcactcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - KIAA1143
- syntaxin 10
- calneuron 1
- kallikrein 1

Buy CLDN15-claudin 15 Gene now

Add to cart