STX10-syntaxin 10 Gene View larger

STX10-syntaxin 10 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STX10-syntaxin 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about STX10-syntaxin 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017237
Product type: DNA & cDNA
Ncbi symbol: STX10
Origin species: Human
Product name: STX10-syntaxin 10 Gene
Size: 2ug
Accessions: BC017237
Gene id: 8677
Gene description: syntaxin 10
Synonyms: SYN10; hsyn10; syntaxin-10; syntaxin 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctctcgaagaccccttttttgtagtccgaggcgaggtgcagaaggcggtgaacacggcccgcgggctgtaccagcgctggtgcgagctcctgcaggaaagcgcggcggtcggacgcgaggagctggactggacgaccaatgagctgcggaatggcctgcgcagcatcgagtgggacctcgaggacctggaagagaccatcggtatagtggaagccaacccaggcaagccagctgcccagaagtcacccagcgacctgctggatgccagcgcagtctcggccacatctcgctacatcgaggagcagcaggccacacagcagctgatcatggatgaacaggatcaacagctggagatggtgtctgggagcatccaggttctgaagcacatgtccggccgcgttggagaagagctggacgagcagggcatcatgctggatgccttcgcccaagagatggaccacacccagtcccgcatggacggggtcctcaggaagttggccaaagtatcccacatgacgagtgaccgccgacagtggtgtgccatcgccgtgctagtgggggtgcttctcctcgttctcatcttactattctctctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calneuron 1
- kallikrein 1
- elastase 2A
- flotillin 2

Buy STX10-syntaxin 10 Gene now

Add to cart