FLOT2-flotillin 2 Gene View larger

FLOT2-flotillin 2 Gene

PTXBC017292

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FLOT2-flotillin 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FLOT2-flotillin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017292
Product type: DNA & cDNA
Ncbi symbol: FLOT2
Origin species: Human
Product name: FLOT2-flotillin 2 Gene
Size: 2ug
Accessions: BC017292
Gene id: 2319
Gene description: flotillin 2
Synonyms: ECS-1; ECS1; ESA; ESA1; M17S1; flotillin-2; Flotillin 2 (epidermal surface antigen 1); epidermal surface antigen; membrane component chromosome 17 surface marker 1; membrane component, chromosome 17, surface marker 1 (35kD protein identified by monoclonal antibody ECS-1); flotillin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgttgcagccccgctgcgaggacgtagagacggccgagggggtagctttaactgtgacgggtgtcgcccaggtgaagatcatgacggagaaggaactcctggccgtggcttgtgagcagtttctgggtaagaatgtgcaggacatcaaaaacgtcgtcctgcagaccctggagggacatctgcgctccatcctcgggaccctgacagtggagcagatttatcaggaccgggaccagtttgccaagctggtgcgggaggtggcagcccctgatgttggccgcatgggcattgagatcctcagcttcaccatcaaggacgtgtatgacaaagtggactatctgagctccctgggcaagacgcagactgccgtggtgcagagagatgctgacattggcgtggccgaggctgaacgggacgcaggcatccgggaagctgagtgcaagaaggagatgctggatgtgaagttcatggcagacaccaagattgctgactctaagcgagccttcgagctgcaaaagtcagccttcagtgaggaggttaacatcaagacagctgaggcccagttggcctatgagctgcagggggcccgtgaacagcagaagatccggcaggaagagattgagattgaggttgtgcagcgcaagaaacagattgccgtggaggcacaggagatcctgcgtacggacaaggagctcatcgctacagtgcgccggcctgccgaggccgaggcccaccgcatccagcagattgccgagggtgaaaaggtgaagcaggtcctcttggcacaggcagaggctgagaagatccgcaaaatcggggaggcggaagcggcagtcatcgaggcgatgggcaaggcagaggctgagcggatgaagctcaaggcagaagcctaccagaaatacggggatgcagccaagatggccttggtgctagaggccctgccccagattgctgccaaaatcgctgccccacttaccaaggtcgatgagattgtggtcctcagtggagacaacagtaaggtcacatcagaagtgaaccgactgctggccgagctgcctgcctctgtgcatgccctcacaggcgtggacctgtctaagatacccctgatcaagaaggccactggtgtgcaggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - KIAA0494
- importin 11
- KIAA0090
- KIAA1305

Buy FLOT2-flotillin 2 Gene now

Add to cart