Login to display prices
Login to display prices
KIAA1305-KIAA1305 Gene View larger

KIAA1305-KIAA1305 Gene

PTXBC008219

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KIAA1305-KIAA1305 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KIAA1305-KIAA1305 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008219
Product type: DNA & cDNA
Ncbi symbol: KIAA1305
Origin species: Human
Product name: KIAA1305-KIAA1305 Gene
Size: 2ug
Accessions: BC008219
Gene id: 57523
Gene description: KIAA1305
Synonyms: KIAA1305; CGIN1; protein NYNRIN; Cousin of GIN1; NYN domain and retroviral integrase catalytic domain-containing protein; protein cousin of GIN1; NYN domain and retroviral integrase containing
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggttggcctacctcatttgactccagccaatggagacaattcctgacccctgctttgatggtgttgaccccacaggaatcaaggatcttgatgccaagtgtggcatctctacctgaagagctgcttctgttagacccaggggccccggcctctgttttaagggggcagggcgtctgcaacaggagtggcacacggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - complexin 1
- sulfatase 2
- cytohesin 3
- glyoxalase I