CPLX1-complexin 1 Gene View larger

CPLX1-complexin 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CPLX1-complexin 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CPLX1-complexin 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002471
Product type: DNA & cDNA
Ncbi symbol: CPLX1
Origin species: Human
Product name: CPLX1-complexin 1 Gene
Size: 2ug
Accessions: BC002471
Gene id: 10815
Gene description: complexin 1
Synonyms: CPX-I; CPX1; complexin-1; CPX I; complexin I; synaphin 2; complexin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtttgtgatgaagcaggctctaggaggggccaccaaggacatggggaagatgctggggggtgacgaggagaaggacccagacgccgccaagaaggaggaggagcggcaggaggcgctgcgccaggcggaggaggagcgcaaggccaagtacgccaagatggaggcggagcgcgaggccgtgcgccagggcatccgagacaagtacggcatcaagaagaaggaggagcgcgaggccgaggcccaggccgccatggaggccaactccgaggggagcttgacgcggcccaagaaggccatcccgccgggctgcggggacgaggtggaggaggaggacgagagcatcctggacaccgtcatcaagtacctgcccgggccgctgcaggacatgctcaagaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sulfatase 2
- cytohesin 3
- glyoxalase I
- vasohibin 1

Buy CPLX1-complexin 1 Gene now

Add to cart