Login to display prices
Login to display prices
VASH1-vasohibin 1 Gene View larger

VASH1-vasohibin 1 Gene

PTXBC009031

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VASH1-vasohibin 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VASH1-vasohibin 1 Gene

Proteogenix catalog: PTXBC009031
Ncbi symbol: VASH1
Product name: VASH1-vasohibin 1 Gene
Size: 2ug
Accessions: BC009031
Gene id: 22846
Gene description: vasohibin 1
Synonyms: KIAA1036; vasohibin-1; vasohibin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaggggggaagaaggtggctgggggtggcagcagcggtgccactccaacgtccgctgcggccaccgccccctctggggtcaggcgtttggagaccagcgaaggaacctcagcccagagagatgaggagccagaagaggaaggggaagaggacctgcgagacggaggcgtccccttctttgtcaaccggggtgggctacctgtggatgaggccacctgggaaaggatgtggaaacacgtggccaagatccaccccgatggagagaaggtggcgcaacggatccgtggggccacagacctgcccaagatccccataccgagtgtgcctacgttccagccgtctacacctgtccctgagcgcctggaagctgtgcagcgctatatcagagagctgcagtacaatcacacagggacacagttctttgaaattaagaagagcagacctctgacagggctgatggacctggccaaggaaatgaccaaagaggccctgccaatcaaatgcctggaagccgtgatcctgggaatgtatccttcctcgcctgaaggggaggggtccgggcttctctgggcctcagcttcctgctctgaaagtgagggtggggtaggttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: