PTXBC008191
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008191 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CYTH3 |
| Origin species: | Human |
| Product name: | CYTH3-cytohesin 3 Gene |
| Size: | 2ug |
| Accessions: | BC008191 |
| Gene id: | 9265 |
| Gene description: | cytohesin 3 |
| Synonyms: | ARNO3; GRP1; PSCD3; cytohesin-3; ARF nucleotide-binding site opener 3; PH, SEC7 and coiled-coil domain-containing protein 3; general receptor of phosphoinositides 1; pleckstrin homology, Sec7 and coiled-coil domains 3; cytohesin 3 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaccgcggcatcaacgagggcggggacctccctgaggagctgctgaggaatttgtatgagagcattaagaacgagccatttaagatcccggaggacgacgggaacgacctgacccacaccttcttcaaccccgaccgcgagggctggctcctgaagctgggagggcgtgtgaagacctggaagcgccggtggttcatcctgaccgataactgcctctattactttgaatacacaacagataaggagcccaggggaatcatcccgttggaaaacctcagcatcagggaggtggaggacccccggaaacccaactgttttgagctctacaatcccagccacaaagggcaggtcatcaaggcctgtaagacggaggccgacggccgcgtggtagaggggaaccatgtggtgtaccggatctcagccccgagcccggaggagaaggaggagtggatgaaatccatcaaagccagtatcagcagagatcccttctatgacatgttggcaacgaggaaacgaaggattgccaataaaaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - glyoxalase I - vasohibin 1 - homeobox B6 - KIAA1257 |