CYTH3-cytohesin 3 Gene View larger

CYTH3-cytohesin 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYTH3-cytohesin 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CYTH3-cytohesin 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008191
Product type: DNA & cDNA
Ncbi symbol: CYTH3
Origin species: Human
Product name: CYTH3-cytohesin 3 Gene
Size: 2ug
Accessions: BC008191
Gene id: 9265
Gene description: cytohesin 3
Synonyms: ARNO3; GRP1; PSCD3; cytohesin-3; ARF nucleotide-binding site opener 3; PH, SEC7 and coiled-coil domain-containing protein 3; general receptor of phosphoinositides 1; pleckstrin homology, Sec7 and coiled-coil domains 3; cytohesin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaccgcggcatcaacgagggcggggacctccctgaggagctgctgaggaatttgtatgagagcattaagaacgagccatttaagatcccggaggacgacgggaacgacctgacccacaccttcttcaaccccgaccgcgagggctggctcctgaagctgggagggcgtgtgaagacctggaagcgccggtggttcatcctgaccgataactgcctctattactttgaatacacaacagataaggagcccaggggaatcatcccgttggaaaacctcagcatcagggaggtggaggacccccggaaacccaactgttttgagctctacaatcccagccacaaagggcaggtcatcaaggcctgtaagacggaggccgacggccgcgtggtagaggggaaccatgtggtgtaccggatctcagccccgagcccggaggagaaggaggagtggatgaaatccatcaaagccagtatcagcagagatcccttctatgacatgttggcaacgaggaaacgaaggattgccaataaaaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glyoxalase I
- vasohibin 1
- homeobox B6
- KIAA1257

Buy CYTH3-cytohesin 3 Gene now

Add to cart