Login to display prices
Login to display prices
CYTH3-cytohesin 3 Gene View larger

CYTH3-cytohesin 3 Gene

PTXBC008191

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYTH3-cytohesin 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CYTH3-cytohesin 3 Gene

Proteogenix catalog: PTXBC008191
Ncbi symbol: CYTH3
Product name: CYTH3-cytohesin 3 Gene
Size: 2ug
Accessions: BC008191
Gene id: 9265
Gene description: cytohesin 3
Synonyms: ARNO3; GRP1; PSCD3; cytohesin-3; ARF nucleotide-binding site opener 3; PH, SEC7 and coiled-coil domain-containing protein 3; general receptor of phosphoinositides 1; pleckstrin homology, Sec7 and coiled-coil domains 3; cytohesin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaccgcggcatcaacgagggcggggacctccctgaggagctgctgaggaatttgtatgagagcattaagaacgagccatttaagatcccggaggacgacgggaacgacctgacccacaccttcttcaaccccgaccgcgagggctggctcctgaagctgggagggcgtgtgaagacctggaagcgccggtggttcatcctgaccgataactgcctctattactttgaatacacaacagataaggagcccaggggaatcatcccgttggaaaacctcagcatcagggaggtggaggacccccggaaacccaactgttttgagctctacaatcccagccacaaagggcaggtcatcaaggcctgtaagacggaggccgacggccgcgtggtagaggggaaccatgtggtgtaccggatctcagccccgagcccggaggagaaggaggagtggatgaaatccatcaaagccagtatcagcagagatcccttctatgacatgttggcaacgaggaaacgaaggattgccaataaaaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: