NRP2-neuropilin 2 Gene View larger

NRP2-neuropilin 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NRP2-neuropilin 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NRP2-neuropilin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009222
Product type: DNA & cDNA
Ncbi symbol: NRP2
Origin species: Human
Product name: NRP2-neuropilin 2 Gene
Size: 2ug
Accessions: BC009222
Gene id: 8828
Gene description: neuropilin 2
Synonyms: NP2; NPN2; PRO2714; VEGF165R2; neuropilin-2; neuropilin-2a(17); neuropilin-2a(22); neuropilin-2b(0); receptor for VEGF165 and semaphorins class3; vascular endothelial cell growth factor 165 receptor 2; neuropilin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatatgtttcctctcacctgggttttcttagccctctacttttcaagacaccaagtgagaggccaaccagacccaccgtgcggaggtcgtttgaattccaaagatgctggctatatcacctctcccggttacccccaggactacccctcccaccagaactgcgagtggattgtttacgcccccgaacccaaccagaagattgtcctcaacttcaaccctcactttgaaatcgagaagcacgactgcaacttgctgtctgcttggaaaatttcactcacaagccgcagctttgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - parathymosin
- neuregulin 4
- claudin 15
- KIAA1143

Buy NRP2-neuropilin 2 Gene now

Add to cart