PTMS-parathymosin Gene View larger

PTMS-parathymosin Gene

PTXBC007616

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTMS-parathymosin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PTMS-parathymosin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007616
Product type: DNA & cDNA
Ncbi symbol: PTMS
Origin species: Human
Product name: PTMS-parathymosin Gene
Size: 2ug
Accessions: BC007616
Gene id: 5763
Gene description: parathymosin
Synonyms: ParaT
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccaggagagagagtcctcaggaaaaggccccagaggacctgaaggagaagaaggagaaggtggaggagaaggcaagccggaaagagcgaaagaaagaagtggtggaggctccagtcccattggtggtgatggtgggcaaggcatgcagccagcctgaggctactccctctcctggtccccacaggaggaggagaacggggctgaggaggaagaagaagaaactgccgaggatggagaggaggaagatgaaggggaagaagaagatgaggaagaagaagaagaggatgatgaagggcccgcgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - neuregulin 4
- claudin 15
- KIAA1143
- syntaxin 10

Buy PTMS-parathymosin Gene now

Add to cart