NRG4-neuregulin 4 Gene View larger

NRG4-neuregulin 4 Gene

PTXBC017568

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NRG4-neuregulin 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NRG4-neuregulin 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017568
Product type: DNA & cDNA
Ncbi symbol: NRG4
Origin species: Human
Product name: NRG4-neuregulin 4 Gene
Size: 2ug
Accessions: BC017568
Gene id: 145957
Gene description: neuregulin 4
Synonyms: pro-NRG4; HRG4; pro-neuregulin-4, membrane-bound isoform; neuregulin 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaacagatcacgaagagccctgtggtcccagtcacaagtcgttttgcctgaatggggggctttgttatgtgatacctactattcccagcccattttgtaggtgcgttgaaaactatacaggagctcgttgtgaagaggtttttctcccaggctccagcatccaaactaaaagtaacctgtttgaagcttttgtggcattggcggtcctagtaacacttatcattggagccttctacttcctttgcaggaaaggccactttcagagagccagttcagtccagtatgatatcaacctggtagagacgagcagtaccagtgcccaccacagtcatgaacaacactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - claudin 15
- KIAA1143
- syntaxin 10
- calneuron 1

Buy NRG4-neuregulin 4 Gene now

Add to cart