PTXBC017422
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC017422 |
Product type: | DNA & cDNA |
Ncbi symbol: | LOC492311 |
Origin species: | Human |
Product name: | LOC492311-similar to bovine IgA regulatory protein Gene |
Size: | 2ug |
Accessions: | BC017422 |
Gene id: | 492311 |
Gene description: | similar to bovine IgA regulatory protein |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaagaaacgcagtgtgtcgggctgtaatattaccatatttgctgtcatgttctcccatctcagtgctgggaaatcaccatgtggaaaccaagcaaacgtgttgtgcatcagccggcttgagtttgttcaatatcaaagctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - leucine zipper and CTNNBIP1 domain containing - cerebral endothelial cell adhesion molecule - deoxythymidylate kinase (thymidylate kinase) - hydroxysteroid (17-beta) dehydrogenase 10 |