LOC492311-similar to bovine IgA regulatory protein Gene View larger

LOC492311-similar to bovine IgA regulatory protein Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC492311-similar to bovine IgA regulatory protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LOC492311-similar to bovine IgA regulatory protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017422
Product type: DNA & cDNA
Ncbi symbol: LOC492311
Origin species: Human
Product name: LOC492311-similar to bovine IgA regulatory protein Gene
Size: 2ug
Accessions: BC017422
Gene id: 492311
Gene description: similar to bovine IgA regulatory protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagaaacgcagtgtgtcgggctgtaatattaccatatttgctgtcatgttctcccatctcagtgctgggaaatcaccatgtggaaaccaagcaaacgtgttgtgcatcagccggcttgagtttgttcaatatcaaagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine zipper and CTNNBIP1 domain containing
- cerebral endothelial cell adhesion molecule
- deoxythymidylate kinase (thymidylate kinase)
- hydroxysteroid (17-beta) dehydrogenase 10

Buy LOC492311-similar to bovine IgA regulatory protein Gene now

Add to cart