Login to display prices
Login to display prices
LOC492311-similar to bovine IgA regulatory protein Gene View larger

LOC492311-similar to bovine IgA regulatory protein Gene

PTXBC017422

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC492311-similar to bovine IgA regulatory protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC492311-similar to bovine IgA regulatory protein Gene

Proteogenix catalog: PTXBC017422
Ncbi symbol: LOC492311
Product name: LOC492311-similar to bovine IgA regulatory protein Gene
Size: 2ug
Accessions: BC017422
Gene id: 492311
Gene description: similar to bovine IgA regulatory protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagaaacgcagtgtgtcgggctgtaatattaccatatttgctgtcatgttctcccatctcagtgctgggaaatcaccatgtggaaaccaagcaaacgtgttgtgcatcagccggcttgagtttgttcaatatcaaagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: