POLA2-polymerase (DNA directed), alpha 2 (70kD subunit) Gene View larger

POLA2-polymerase (DNA directed), alpha 2 (70kD subunit) Gene

PTXBC001347

New product

Data sheet of POLA2-polymerase (DNA directed), alpha 2 (70kD subunit) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POLA2-polymerase (DNA directed), alpha 2 (70kD subunit) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC001347
Product type: DNA & cDNA
Ncbi symbol: POLA2
Origin species: Human
Product name: POLA2-polymerase (DNA directed), alpha 2 (70kD subunit) Gene
Size: 2ug
Accessions: BC001347
Gene id: 23649
Gene description: polymerase (DNA directed), alpha 2 (70kD subunit)
Synonyms: DNA polymerase alpha subunit B; DNA polymerase alpha 70 kDa subunit; polymerase (DNA directed), alpha 2 (70kD subunit); polymerase (DNA directed), alpha 2, accessory subunit; polymerase (DNA) alpha 2, accessory subunit; polymerase (DNA-directed), alpha (70kD); DNA polymerase alpha 2, accessory subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgcatccgcccagcagctggcggaggagctgcagatcttcggcctagactgcgaggaggctctaattgagaaattggtagagctttgtgttcagtatggacagaatgaggagggaatggtaggcgagcttatagccttctgcaccagcacacataaagttggccttacctcagagatcctgaactcttttgagcatgagtttctgagcaaaagattatcgaaagccaggcatagtacctgcaaggacagtggccatgcaggagctagagacattgtttccattcaagagctaattgaagtggaagaagaagaggaaatcctcttgaactcttacaccacaccttcaaagggttctcagaagcgagctatctctaccccagaaacccccctaacaaaaaggagtgtgtcaactcgtagcccccatcagctactctcaccgtcaagtttctctccaagtgctactccctcccagaaatacaactcacgaagtaaccgaggagaagtggttacctccttcggcttagcacagggagtatcttggtctgggagaggaggagctggaaacatcagcctgaaggtcttgggatgtccagaggcactaactgggagctacaaatccatgtttcagaagctcccagacattcgagaagttctgacctgtaagatagaagaacttggcagcgaactcaaggaacattacaagattgaagctttcactcctttgctagccccagcacaggagcctgtcactctgctgggccagattggctgtgatagcaacgggaagctgaacaacaagtcagtgattctcgagggagaccgggaacattcctcgggtgctcaaattccagtggatttatctgagcttaaggaatattctctgtttcctggacaggttgtaattatggaaggaatcaacaccactggtaggaaacttgttgccaccaaactctacgagggtgtgccacttccattttatcagcccactgaagaggatgcagactttgagcaaagcatggtcctggttgcctgtggaccatacaccacatctgacagcatcacgtatgaccccctgcttgacctgattgctgtcatcaaccatgaccggccagatgtctgcatcctgtttggccctttcctggatgctaagcatgaacaggtggagaattgtctactgacaagtccatttgaagacattttcaagcagtgtctacgaacaattattgaaggcacaagaagctccggctcccaccttgtctttgtcccgtcattgagagatgtgcaccatgagcctgtgtacccccagccgcctttcagctactccgatctgtctcgagaggacaaaaagcaagtacagtttgtgtccgagccctgcagcctctccataaacggagtgatcttcggcttgacatccacagatctgcttttccacctgggggccgaggagatcagtagttcttccggaacttcagacagattcagccgaatactcaagcacatcttgacccagaggagctactacccactctacccgccccaagaagacatggccattgactatgagtcgttctatgtttacgcacagctgcctgtcaccccagatgtcctcatcatcccgtcagagctgaggtacttcgtgaaggatgtcctcggctgtgtctgtgtgaaccctgggcgccttaccaaagggcaggtgggaggcaccttcgcccgactctaccttaggaggccggcagcggacggggcagagaggcagagcccatgcattgctgtgcaggtcgtcaggatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WW domain containing E3 ubiquitin protein ligase 2
- AFG3 ATPase family gene 3-like 1 (S. cerevisiae)
- C1q and tumor necrosis factor related protein 3
- PEST proteolytic signal containing nuclear protein

Buy POLA2-polymerase (DNA directed), alpha 2 (70kD subunit) Gene now

Add to cart