GCNT3-glucosaminyl (N-acetyl) transferase 3, mucin type Gene View larger

GCNT3-glucosaminyl (N-acetyl) transferase 3, mucin type Gene

PTXBC017032

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GCNT3-glucosaminyl (N-acetyl) transferase 3, mucin type Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GCNT3-glucosaminyl (N-acetyl) transferase 3, mucin type Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017032
Product type: DNA & cDNA
Ncbi symbol: GCNT3
Origin species: Human
Product name: GCNT3-glucosaminyl (N-acetyl) transferase 3, mucin type Gene
Size: 2ug
Accessions: BC017032
Gene id: 9245
Gene description: glucosaminyl (N-acetyl) transferase 3, mucin type
Synonyms: C2/4GnT; C24GNT; C2GNT2; C2GNTM; GNTM; beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 3; C2GnT-mucin type; beta1,6-N-acetylglucosaminyltransferase-M; beta1,6GlcNAc-transferase; core 2/core 4 beta-1,6-N-acetylglucosaminyltransferase; hC2GnT-M; mucus-type core 2 beta-1,6-N-acetylglucosaminyltransferase; glucosaminyl (N-acetyl) transferase 3, mucin type
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttcaatggaagagactctgccagctgcattacttgtgggctctgggctgctatatgctgctggccactgtggctctgaaactttctttcaggttgaagtgtgactctgaccacttgggtctggagtccagggaatctcaaagccagtactgtaggaatatcttgtataatttcctgaaacttccagcaaagaggtctatcaactgttcaggggtcacccgaggggaccaagaggcagtgcttcaggctattctgaataacctggaggtcaagaagaagcgagagcctttcacagacacccactacctctccctcaccagagactgtgagcacttcaaggctgaaaggaagttcatacagttcccactgagcaaagaagaggtggagttccctattgcatactctatggtgattcatgagaagattgaaaactttgaaaggctactgcgagctgtgtatgcccctcagaacatatactgtgtccatgtggatgagaagtccccagaaactttcaaagaggcggtcaaagcaattatttcttgcttcccaaatgtcttcatagccagtaagctggttcgggtggtttatgcctcctggtccagggtgcaagctgacctcaactgcatggaagacttgctccagagctcagtgccgtggaaatacttcctgaatacatgtgggacggactttcctataaagagcaatgcagagatggtccaggctctcaagatgttgaatgggaggaatagcatggagtcagaggtacctcctaagcacaaagaaacccgctggaaatatcactttgaggtagtgagagacacattacacctaaccaacaagaagaaggatcctcccccttataatttaactatgtttacagggaatgcgtacattgtggcttcccgagatttcgtccaacatgttttgaagaaccctaaatcccaacaactgattgaatgggtaaaagacacttatagcccagatgaacacctctgggccacccttcagcgtgcacggtggatgcctggctctgttcccaaccaccccaagtacgacatctcagacatgacttctattgccaggctggtcaagtggcagggtcatgagggagacatcgataagggtgctccttatgctccctgctctggaatccaccagcgggctatctgcgtttatggggctggggacttgaattggatgcttcaaaaccatcacctgttggccaacaagtttgacccaaaggtagatgataatgctcttcagtgcttagaagaatacctacgttataaggccatctatgggactgaactttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal RNA processing 1 homolog (S. cerevisiae)
- serine hydroxymethyltransferase 2 (mitochondrial)
- PRP4 pre-mRNA processing factor 4 homolog (yeast)
- polymerase (DNA directed), alpha 2 (70kD subunit)

Buy GCNT3-glucosaminyl (N-acetyl) transferase 3, mucin type Gene now

Add to cart