Login to display prices
Login to display prices
BLNK-B-cell linker Gene View larger

BLNK-B-cell linker Gene

PTXBC018906

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BLNK-B-cell linker Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BLNK-B-cell linker Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018906
Product type: DNA & cDNA
Ncbi symbol: BLNK
Origin species: Human
Product name: BLNK-B-cell linker Gene
Size: 2ug
Accessions: BC018906
Gene id: 29760
Gene description: B-cell linker
Synonyms: BLNK-S; AGM4; BASH; LY57; SLP-65; SLP65; bca; B-cell linker protein; B cell adaptor containing SH2 domain; B-cell activation; B-cell adapter containing a SH2 domain protein; B-cell adapter containing a Src homology 2 domain protein; Src homology 2 domain-containing leukocyte protein of 65 kDa; Src homology [SH2] domain-containing leukocyte protein of 65 kD; cytoplasmic adapter protein; B-cell linker
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacaagcttaataaaataaccgtccccgccagtcagaagttgaggcagcttcaaaagatggtccatgatattaaaaacaatgaaggtggaataatgaataaaatcaaaaagctaaaagtcaaagcacctccaagtgttcctcgaagggactacgcttcagagagccctgctgacgaagagcagcagtggtccgatgactttgacagcgactatgaaaatccagatgagcactcggactcagagatgtacgtgatgcccgccgaggagaacgctgatgacagctacgagccgcctccagtagagcaggaaaccaggccggttcacccagccctgcccttcgccagaggcgagtatatagacaatcgatcaagccagaggcattccccacccttcagcaagacacttcccagtaagcccagctggccttcagagaaagcaaggctcacctccaccctgccggccctgactgctttgcagaaacctcaagtcccacccaaacccaaaggcctccttgaggatgaggctgattatgtggtccccgtggaagataatgatgaaaactatattcatcccacagaaagcagttcacctccacctgaaaaagctcccatggtgaatagatcaaccaagccaaattcctcaacgcccgcctctcctccaggaacagcttcaggtcgaaacagtggggcctgggaaaccaagtcacctccaccagctgcaccatccccgttgccacgggccgggaaaaaaccaacgacaccactgaagacaactccagttgcctctcaacagaatgcttcaagtgtttgtgaagaaaaacctatacctgctgaacgccaccgagggtcaagtcacagacaagaagctgtgcagtcaccagtgtttcctcctgcccagaaacaaatccaccaaaaacccatacctctgccaagatttacagaagggggaaacccaactgtggatgggcccctacccagcttttcatctaattccactatttcagaacaggaagctggcgttctctgcaagccatggtatgctggagcctgtgatcgaaagtctgctgaagaggcattgcacagatcaaacaaggatggatcatttcttattcggaaaagctctggccatgattccaaacaaccatatacactagttgtattctttaataagcgagtatataatattcctgtgcgatttattgaagcaacaaaacaatatgccttgggcagaaagaaaaatggtgaagagtactttggaagtgttgctgaaatcatcaggaatcatcaacatagtcctttggttcttattgacagtcagaataacacaaaagattccaccagactgaagtatgcagttaaagtttcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD99 molecule
- orosomucoid 2
- BCL2-like 1
- CD81 molecule