Login to display prices
Login to display prices
EFEMP2-EGF-containing fibulin-like extracellular matrix protein 2 Gene View larger

EFEMP2-EGF-containing fibulin-like extracellular matrix protein 2 Gene

PTXBC010456

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EFEMP2-EGF-containing fibulin-like extracellular matrix protein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EFEMP2-EGF-containing fibulin-like extracellular matrix protein 2 Gene

Proteogenix catalog: PTXBC010456
Ncbi symbol: EFEMP2
Product name: EFEMP2-EGF-containing fibulin-like extracellular matrix protein 2 Gene
Size: 2ug
Accessions: BC010456
Gene id: 30008
Gene description: EGF-containing fibulin-like extracellular matrix protein 2
Synonyms: ARCL1B; FBLN4; MBP1; UPH1; EGF-containing fibulin-like extracellular matrix protein 2; FIBL-4; fibulin 4; mutant p53 binding protein 1; EGF containing fibulin like extracellular matrix protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcccctgcgcctcctgcctacccgggtctctactgctctgggcgctgctactgttgctcttgggatcagcttctcctcaggattctgaagagcccgacagctacacggaatgcacagatggctatgagtgggacccagacagccagcactgccgggatgtcaacgagtgtctgaccatccctgaggcctgcaagggggaaatgaagtgcatcaaccactacgggggctacttgtgcctgccccgctccgctgccgtcatcaacgacctacacggcgagggacccccgccaccagtgcctcccgctcaacaccccaacccctgcccaccaggctatgagcccgacgatcaggacagctgtgtggatgtggacgagtgtgcccaggccctgcacgactgtcgccccagccaggactgccataacttgcctggctcctatcagtgcacctgccctgatggttaccgcaagatcgggcccgagtgtgtggacatagacgagtgccgctaccgctactgccagcaccgctgcgtgaacctgcctggctccttccgctgccagtgcgagccgggcttccagctggggcctaacaaccgctcctgtgttgatgtgaacgagtgtgacatgggggccccatgcgagcagcgctgcttcaactcctatgggaccttcctgtgtcgctgccaccagggctatgagctgcatcgggatggcttctcctgcagtgatattgatgagtgtagctactccagctacctctgtcagtaccgctgcgtcaacgagccaggccgtttctcctgccactgcccacagggttaccagctgctggccacacgcctctgccaagacattgatgagtgtgagtctggtgcgcaccagtgctccgaggcccaaacctgtgtcaacttccatgggggctaccgctgcgtggacaccaaccgctgcgtggagccctacatccaggtctctgagaaccgctgtctctgcccggcctccaaccctctatgtcgagagcagccttcatccattgtgcaccgctacatgaccatcacctcggagcggagcgtgcccgctgacgtgttccagatccaggcgacctccgtctaccccggtgcctacaatgcctttcagatccgtgctggaaactcgcagggggacttttacattaggcaaatcaacaacgtcagcgccatgctggtcctcgcccggccggtgacgggcccccgggagtacgtgctggacctggagatggtcaccatgaattccctcatgagctaccgggccagctctgtactgaggctcaccgtctttgtaggggcctacaccttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: