SMCR7L-Smith-Magenis syndrome chromosome region, candidate 7-like Gene View larger

SMCR7L-Smith-Magenis syndrome chromosome region, candidate 7-like Gene

PTXBC008327

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SMCR7L-Smith-Magenis syndrome chromosome region, candidate 7-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SMCR7L-Smith-Magenis syndrome chromosome region, candidate 7-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008327
Product type: DNA & cDNA
Ncbi symbol: SMCR7L
Origin species: Human
Product name: SMCR7L-Smith-Magenis syndrome chromosome region, candidate 7-like Gene
Size: 2ug
Accessions: BC008327
Gene id: 54471
Gene description: Smith-Magenis syndrome chromosome region, candidate 7-like
Synonyms: SMCR7L; Smith-Magenis syndrome chromosome region, candidate 7-like; mitochondrial elongation factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggcgctggtgagcgcaaaggcaagaaggatgacaatggcattggcacggccattgactttgtgctctccaatgcccggctggtgctgggggtgggtggagcggccatgctgggcatcgccacgctggcagttaagcggatgtacgatcgggcgatcagtgcccctaccagccccacccgcctgagccattcggggaaaaggagctgggaagaacccaactggatgggctccccacgactgctgaacagggacatgaagacgggcctgagccggtccttgcagacccttcccacagactcctccaccttcgacacagatacattctgcccgccccggcccaagccagtggccaggaagggccaggtagacttgaagaagtcacgactccgcatgtccctgcaggagaaacttcttacttactaccggaaccgggcagccatccctgctggagagcaggctcgggccaagcaagctgctgtggacatatgtgccgagctccggagcttcctgcgggccaagttgcctgacatgccgcttcgggacatgtacttgagtggcagcctctacgatgacctgcaggtggtgacagctgaccacatccaactcattgtgccccttgtgctggagcagaacctgtggtcatgtattcctggtgaagacaccatcatgaatgtccctggcttcttcctggtgcgtcgtgagaatccagagtactttcctcgtgggagcagttactgggaccgctgtgtagtagggggctacctctctccaaagacagtcgcagatacatttgagaaggtagtggctggctccatcaattggccagccatagggtccctcttggactatgtgatccgcccggccccacccccagaagccctcacactggaggtgcagtatgagcgtgacaaacatctcttcattgacttcctgccatcagtgaccctcggtgacacagtcttggtggccaaaccacaccggctagcccagtatgacaacctgtggcggctgagcctgcgtcccgcggagacggcacgcctgcgggctctggaccaggctgactcgggctgccgatctctgtgcctcaagatcctcaaggccatatgcaagtccaccccggctctgggccacctcactgccagccagctaaccaatgtcatcctccacttggcccaggaggaggctgactggtctccggatatgctggccgaccgtttcctgcaggccttgaggggacttatcagctacttagaggctggagtcctgcccagtgccctaaaccccaaggtgaacttatttgcagagctcacccctgaagaaatagacgaattaggatacactctgtattgctcattgtctgagccagaggtgctgctgcagacgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interferon-induced protein with tetratricopeptide repeats 5
- interferon-induced protein with tetratricopeptide repeats 3
- small nuclear RNA activating complex, polypeptide 5, 19kDa
- glycerophosphodiester phosphodiesterase domain containing 5

Buy SMCR7L-Smith-Magenis syndrome chromosome region, candidate 7-like Gene now

Add to cart