IFIT5-interferon-induced protein with tetratricopeptide repeats 5 Gene View larger

IFIT5-interferon-induced protein with tetratricopeptide repeats 5 Gene

PTXBC025786

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFIT5-interferon-induced protein with tetratricopeptide repeats 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IFIT5-interferon-induced protein with tetratricopeptide repeats 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025786
Product type: DNA & cDNA
Ncbi symbol: IFIT5
Origin species: Human
Product name: IFIT5-interferon-induced protein with tetratricopeptide repeats 5 Gene
Size: 2ug
Accessions: BC025786
Gene id: 24138
Gene description: interferon-induced protein with tetratricopeptide repeats 5
Synonyms: ISG58; P58; RI58; interferon-induced protein with tetratricopeptide repeats 5; IFIT-5; interferon-induced 58 kDa protein; retinoic acid- and interferon-inducible 58 kDa protein; retinoic acid- and interferon-inducible protein (58kD); interferon induced protein with tetratricopeptide repeats 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgaaattcgtaaggacaccttgaaggccattctgttggagttagaatgtcattttacatggaatttacttaaggaagacattgatctgtttgaggtagaagatacaattgggcaacagcttgaatttcttaccacaaaatctagacttgctctttataacctattggcctatgtgaaacacctaaaaggccaaaataaagacgcccttgagtgcttggaacaagcagaagaaataatccagcaagaacactcagacaaagaagaagtacgaagcctggtcacttggggaaactatgcctgggtgtattatcacatggaccagcttgaagaagctcagaagtatacaggtaagatagggaatgtctgtaagaaattgtccagtccttctaactacaagttggagtgtcctgagactgactgtgagaaaggctgggcactcttgaaatttggaggaaagtattatcaaaaggctaaagcggcttttgagaaggctctggaagtggagcctgacaatccagaatttaacatcggctatgctatcacagtgtatcggctggatgattctgatagagaagggtctgtaaagagcttttctctggggcctttgagaaaggctgttaccctgaacccagataacagctatattaaggtttttctggcactgaagcttcaagatgtacatgcagaagctgaaggggaaaagtatattgaagaaatcctggaccaaatatcatcccagccttacgtccttcgttatgcagccaagttctataggagaaaaaattcctggaacaaagctctcgaacttttaaaaaaggccttggaggtgacaccaacttcttctttcctgcatcaccagatgggactttgctacagggcacaaatgatccaaatcaagaaggccacacacaacagacctaaaggaaaggataaactaaaggttgatgagctgatttcatctgctatatttcatttcaaagcagccatggaacgagactctatgtttgcatttgcctacacagacctggccaacatgtatgctgaaggaggccagtatagcaatgctgaggacattttccggaaagctcttcgtctggagaacataaccgatgatcacaaacatcagatccattaccactatggccgctttcaggaatttcaccgtaaatcagaaaatactgccatccatcattatttagaagccttaaaggtcaaagacagatcaccccttcgcaccaaactgacaagtgctctgaagaaattgtctaccaagagactttgtcacaatgctttagatgtgcagagtttaagtgccctagggtttgtttacaagctggaaggagaaaagaggcaagctgctgagtactatgagaaggcacaaaagatagatccagaaaatgcagaattcctgactgctctctgtgagctccgactttccatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interferon-induced protein with tetratricopeptide repeats 3
- small nuclear RNA activating complex, polypeptide 5, 19kDa
- glycerophosphodiester phosphodiesterase domain containing 5
- TIP41, TOR signaling pathway regulator-like (S. cerevisiae)

Buy IFIT5-interferon-induced protein with tetratricopeptide repeats 5 Gene now

Add to cart