Login to display prices
Login to display prices
IFIT5-interferon-induced protein with tetratricopeptide repeats 5 Gene View larger

IFIT5-interferon-induced protein with tetratricopeptide repeats 5 Gene

PTXBC025786

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFIT5-interferon-induced protein with tetratricopeptide repeats 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IFIT5-interferon-induced protein with tetratricopeptide repeats 5 Gene

Proteogenix catalog: PTXBC025786
Ncbi symbol: IFIT5
Product name: IFIT5-interferon-induced protein with tetratricopeptide repeats 5 Gene
Size: 2ug
Accessions: BC025786
Gene id: 24138
Gene description: interferon-induced protein with tetratricopeptide repeats 5
Synonyms: ISG58; P58; RI58; interferon-induced protein with tetratricopeptide repeats 5; IFIT-5; interferon-induced 58 kDa protein; retinoic acid- and interferon-inducible 58 kDa protein; retinoic acid- and interferon-inducible protein (58kD); interferon induced protein with tetratricopeptide repeats 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgaaattcgtaaggacaccttgaaggccattctgttggagttagaatgtcattttacatggaatttacttaaggaagacattgatctgtttgaggtagaagatacaattgggcaacagcttgaatttcttaccacaaaatctagacttgctctttataacctattggcctatgtgaaacacctaaaaggccaaaataaagacgcccttgagtgcttggaacaagcagaagaaataatccagcaagaacactcagacaaagaagaagtacgaagcctggtcacttggggaaactatgcctgggtgtattatcacatggaccagcttgaagaagctcagaagtatacaggtaagatagggaatgtctgtaagaaattgtccagtccttctaactacaagttggagtgtcctgagactgactgtgagaaaggctgggcactcttgaaatttggaggaaagtattatcaaaaggctaaagcggcttttgagaaggctctggaagtggagcctgacaatccagaatttaacatcggctatgctatcacagtgtatcggctggatgattctgatagagaagggtctgtaaagagcttttctctggggcctttgagaaaggctgttaccctgaacccagataacagctatattaaggtttttctggcactgaagcttcaagatgtacatgcagaagctgaaggggaaaagtatattgaagaaatcctggaccaaatatcatcccagccttacgtccttcgttatgcagccaagttctataggagaaaaaattcctggaacaaagctctcgaacttttaaaaaaggccttggaggtgacaccaacttcttctttcctgcatcaccagatgggactttgctacagggcacaaatgatccaaatcaagaaggccacacacaacagacctaaaggaaaggataaactaaaggttgatgagctgatttcatctgctatatttcatttcaaagcagccatggaacgagactctatgtttgcatttgcctacacagacctggccaacatgtatgctgaaggaggccagtatagcaatgctgaggacattttccggaaagctcttcgtctggagaacataaccgatgatcacaaacatcagatccattaccactatggccgctttcaggaatttcaccgtaaatcagaaaatactgccatccatcattatttagaagccttaaaggtcaaagacagatcaccccttcgcaccaaactgacaagtgctctgaagaaattgtctaccaagagactttgtcacaatgctttagatgtgcagagtttaagtgccctagggtttgtttacaagctggaaggagaaaagaggcaagctgctgagtactatgagaaggcacaaaagatagatccagaaaatgcagaattcctgactgctctctgtgagctccgactttccatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: