Login to display prices
Login to display prices
SNAPC5-small nuclear RNA activating complex, polypeptide 5, 19kDa Gene View larger

SNAPC5-small nuclear RNA activating complex, polypeptide 5, 19kDa Gene

PTXBC014315

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNAPC5-small nuclear RNA activating complex, polypeptide 5, 19kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNAPC5-small nuclear RNA activating complex, polypeptide 5, 19kDa Gene

Proteogenix catalog: PTXBC014315
Ncbi symbol: SNAPC5
Product name: SNAPC5-small nuclear RNA activating complex, polypeptide 5, 19kDa Gene
Size: 2ug
Accessions: BC014315
Gene id: 10302
Gene description: small nuclear RNA activating complex, polypeptide 5, 19kDa
Synonyms: snRNA-activating protein complex subunit 5; SNAPc 19 kDa subunit; SNAPc subunit 5; snRNA-activating protein complex 19 kDa subunit; small nuclear RNA activating complex polypeptide 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgagccggcttcaggaactgcgcaaggaggaggagacgctgctgcggttgaaggcagccctgcacgaccagctgaaccgcctcaagatgttggtgcatgtagacaatgaagcatcaatcaaccaaacaaccctggagctgagcacaaagagtcatgtgacggaagaggaggaggaggaagaggaagaagaatcagattcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: