Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SNAPC5-small nuclear RNA activating complex, polypeptide 5, 19kDa Gene
PTXBC014315
New product
Data sheet of SNAPC5-small nuclear RNA activating complex, polypeptide 5, 19kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNAPC5-small nuclear RNA activating complex, polypeptide 5, 19kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014315 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNAPC5 |
| Origin species: | Human |
| Product name: | SNAPC5-small nuclear RNA activating complex, polypeptide 5, 19kDa Gene |
| Size: | 2ug |
| Accessions: | BC014315 |
| Gene id: | 10302 |
| Gene description: | small nuclear RNA activating complex, polypeptide 5, 19kDa |
| Synonyms: | snRNA-activating protein complex subunit 5; SNAPc 19 kDa subunit; SNAPc subunit 5; snRNA-activating protein complex 19 kDa subunit; small nuclear RNA activating complex polypeptide 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgagccggcttcaggaactgcgcaaggaggaggagacgctgctgcggttgaaggcagccctgcacgaccagctgaaccgcctcaagatgttggtgcatgtagacaatgaagcatcaatcaaccaaacaaccctggagctgagcacaaagagtcatgtgacggaagaggaggaggaggaagaggaagaagaatcagattcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glycerophosphodiester phosphodiesterase domain containing 5 - TIP41, TOR signaling pathway regulator-like (S. cerevisiae) - v-rel reticuloendotheliosis viral oncogene homolog A (avian) - small nuclear RNA activating complex, polypeptide 1, 43kDa |