Login to display prices
Login to display prices
RELA-v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene View larger

RELA-v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene

PTXBC014095

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RELA-v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RELA-v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014095
Product type: DNA & cDNA
Ncbi symbol: RELA
Origin species: Human
Product name: RELA-v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene
Size: 2ug
Accessions: BC014095
Gene id: 5970
Gene description: v-rel reticuloendotheliosis viral oncogene homolog A (avian)
Synonyms: RELA proto-oncogene, NF-kB subunit; NFKB3; transcription factor p65; NF-kappa-B p65delta3; NF-kappa-B transcription factor p65; nuclear factor NF-kappa-B p65 subunit; nuclear factor of kappa light polypeptide gene enhancer in B-cells 3; v-rel avian reticuloendotheliosis viral oncogene homolog A; v-rel reticuloendotheliosis viral oncogene homolog A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgaactgttccccctcatcttcccggcagagccagcccaggcctctggcccctatgtggagatcattgagcagcccaagcagcggggcatgcgcttccgctacaagtgcgaggggcgctccgcgggcagcatcccaggcgagaggagcacagataccaccaagacccaccccaccatcaagatcaatggctacacaggaccagggacagtgcgcatctccctggtcaccaaggaccctcctcaccggcctcacccccacgagcttgtaggaaaggactgccgggatggcttctatgaggctgagctctgcccggaccgctgcatccacagtttccagaacctgggaatccagtgtgtgaagaagcgggacctggagcaggctatcagtcagcgcatccagaccaacaacaaccccttccaagttcctatagaagagcagcgtggggactacgacctgaatgctgtgcggctctgcttccaggtgacagtgcgggacccatcaggcaggcccctccgcctgccgcctgtcctttctcatcccatctttgacaatcgtgcccccaacactgccgagctcaagatctgccgagtgaaccgaaactctggcagctgcctcggtggggatgagatcttcctactgtgtgacaaggtgcagaaagaggacattgaggtgtgtccccaagccagcaccccagccctatccctttacgtcatccctgagcaccatcaactatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - small nuclear RNA activating complex, polypeptide 1, 43kDa
- eukaryotic translation initiation factor 2-alpha kinase 1
- ADAM metallopeptidase with thrombospondin type 1 motif, 1
- integrin, alpha 5 (fibronectin receptor, alpha polypeptide)