SNAPC1-small nuclear RNA activating complex, polypeptide 1, 43kDa Gene View larger

SNAPC1-small nuclear RNA activating complex, polypeptide 1, 43kDa Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNAPC1-small nuclear RNA activating complex, polypeptide 1, 43kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SNAPC1-small nuclear RNA activating complex, polypeptide 1, 43kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014984
Product type: DNA & cDNA
Ncbi symbol: SNAPC1
Origin species: Human
Product name: SNAPC1-small nuclear RNA activating complex, polypeptide 1, 43kDa Gene
Size: 2ug
Accessions: BC014984
Gene id: 6617
Gene description: small nuclear RNA activating complex, polypeptide 1, 43kDa
Synonyms: PTFgamma; SNAP43; snRNA-activating protein complex subunit 1; PSE-binding factor subunit gamma; PTF subunit gamma; SNAPc 43 kDa subunit; SNAPc subunit 1; proximal sequence element-binding transcription factor subunit gamma; small nuclear RNA activating complex, polypeptide 1, 43kD; small nuclear RNA activating complex, polypeptide 1, 43kDa; snRNA-activating protein complex 43 kDa subunit; small nuclear RNA activating complex polypeptide 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggactcctcccggcctgcagaccgactgcgaggcgctgctcagccgcttccaggagacggacagtgtacgcttcgaggacttcacggagctctggagaaacatgaagttcgggactatcttctgtggcagaatgagaaatttagaaaagaacatgtttacaaaagaagctttagctttggcttggcgatattttttacctccatacaccttccagatcagagttggtgctttgtatctgctatatggattatataatacccaactgtgtcaaccaaaacaaaagatcagagttgccctgaaggattgggatgaagttttaaaatttcagcaagatttagtaaatgcacagcattttgatgcagcttatatttttaggaagctacgactagacagagcatttcactttacagcaatgcccaaattgctgtcatataggatgaagaaaaaaattcaccgagctgaagttacagaagaatttaaggacccaagtgatcgtgtgatgaaacttatcacttctgatgtattagaggaaatgctgaatgttcatgatcattatcagaacatgaaacatgtaatttcagttgataagtccaagccagataaagccctcagcttgataaaggatgatttttttgacaatattaagaacatagttttggagcatcagcagtggcacaaagacagaaagaatccatccttaaagtcaaaaactaatgatggagaagaaaaaatggaaggaaattcacaagaaacggagagatgtgaaagggcagaatcattagcgaaaataaaatcaaaggccttttcagttgtcatacaggcatccaaatcaagaaggcatcgtcaagtcaaactcgactcttctgactctgattctgcatctggtcaagggcaagtcaaagcaactaggaaaaaagagaagaaagaaagattgaaaccagcaggaaggaagatgtctctcagaaacaaaggcaatgtgcagaatatacacaaggaagataaacctttaagtctgagtatgcctgtaattacagaagaagaagagaatgaaagtttgagtggaacagagttcactgcatccaagaagaggagaaaacactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 2-alpha kinase 1
- ADAM metallopeptidase with thrombospondin type 1 motif, 1
- integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
- COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)

Buy SNAPC1-small nuclear RNA activating complex, polypeptide 1, 43kDa Gene now

Add to cart