Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
COX16-COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) Gene
PTXBC001702
New product
Data sheet of COX16-COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COX16-COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001702 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COX16 |
| Origin species: | Human |
| Product name: | COX16-COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC001702 |
| Gene id: | 51241 |
| Gene description: | COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) |
| Synonyms: | COX16, cytochrome c oxidase assembly homolog; cytochrome c oxidase assembly protein COX16 homolog, mitochondrial; C14orf112; HSPC203; cytochrome c oxidase assembly factor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttgcacccgcggtgatgcgtgcttttcgcaagaacaagactctcggctatggagtccccatgttgttgctgattgttggaggttcttttggtcttcgtgagttttctcaaatccgatatgatgctgtgaagagtaaaatggatcctgagcttgaaaaaaaactgaaagagaataaaatatctttagagtcggaatatgagaaaatcaaagactccaagtttgatgactggaagaatattcgaggacccaggccttgggaagatcctgacctcctccaaggaagaaatccagaaagccttaagactaagacaacttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pregnancy up-regulated non-ubiquitously expressed CaM kinase - ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) - ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) - nudix (nucleoside diphosphate linked moiety X)-type motif 6 |