UBE2E3-ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) Gene View larger

UBE2E3-ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) Gene

PTXBC003554

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2E3-ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2E3-ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003554
Product type: DNA & cDNA
Ncbi symbol: UBE2E3
Origin species: Human
Product name: UBE2E3-ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) Gene
Size: 2ug
Accessions: BC003554
Gene id: 10477
Gene description: ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast)
Synonyms: UBCH9; UbcM2; ubiquitin-conjugating enzyme E2 E3; E2 ubiquitin-conjugating enzyme E3; ubiquitin carrier protein E3; ubiquitin conjugating enzyme E2E 3; ubiquitin-conjugating enzyme E2-23 kDa; ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast); ubiquitin-conjugating enzyme E2E 3 (homologous to yeast UBC4/5); ubiquitin-protein ligase E3; ubiquitin conjugating enzyme E2 E3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccagtgataggcaaaggtccgatgatgagagccccagcaccagcagtggcagttcagatgcggaccagcgagacccagccgctccagagcctgaagaacaagaggaaagaaaaccttctgccacccagcagaagaaaaacaccaaactctctagcaaaaccactgctaagttatccactagtgctaaaagaattcagaaggagctagctgaaataacccttgatcctcctcctaattgcagtgctgggcctaaaggagataacatttatgaatggagatcaactatacttggtccaccgggttctgtatatgaaggtggtgtgttttttctggatatcacattttcatcagattatccatttaagccaccaaaggttactttccgcaccagaatctatcactgcaacatcaacagtcagggagtcatctgtctggacatccttaaagacaactggagtcccgctttgactatttcaaaggttttgctgtctatttgttcccttttgacagactgcaaccctgcggatcctctggttggaagcatagccactcagtatttgaccaacagagcagaacacgacaggatagccagacagtggaccaagagatacgcaacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nudix (nucleoside diphosphate linked moiety X)-type motif 6
- nudix (nucleoside diphosphate linked moiety X)-type motif 9
- megalencephalic leukoencephalopathy with subcortical cysts 1
- phosphatidylinositol-5-phosphate 4-kinase, type II, alpha

Buy UBE2E3-ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) Gene now

Add to cart