Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUDT6-nudix (nucleoside diphosphate linked moiety X)-type motif 6 Gene
PTXBC009842
New product
Data sheet of NUDT6-nudix (nucleoside diphosphate linked moiety X)-type motif 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUDT6-nudix (nucleoside diphosphate linked moiety X)-type motif 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009842 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUDT6 |
| Origin species: | Human |
| Product name: | NUDT6-nudix (nucleoside diphosphate linked moiety X)-type motif 6 Gene |
| Size: | 2ug |
| Accessions: | BC009842 |
| Gene id: | 11162 |
| Gene description: | nudix (nucleoside diphosphate linked moiety X)-type motif 6 |
| Synonyms: | ASFGF2; FGF-AS; FGF2AS; GFG-1; GFG1; nucleoside diphosphate-linked moiety X motif 6; antisense basic fibroblast growth factor; nudix (nucleoside diphosphate linked moiety X)-type motif 6; nudix hydrolase 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggcagccgctgagctggggccgctggcgcgcgatgcttgcccgaacctacggccccgggccttcggcgggttaccgctgggcctcgggcgcacagggttacgtgcggaatccgccagttggagcgtgcgatctgcagggcgagctggacagattcgggggcatctcggtgcgcctggcgcggctcgatgcgctggaccgcctggacgctgccgccttccagaagggcttgcaggctgcagtacagcaatggcgatcagaaggtagaacagctgtatggctgcacattcccatcctccaaagccgatttattgcccctgctgcttccctgggcttctgctttcaccacgcagaatcggattcatcaacgttgactctgtggctgagagaagggcccagcagattaccaggatatgcttcacatcaagtaggagttgcaggagctgtatttgatgaaagtactagaaaaatactggttgtacaagatcgaaataaattgaaaaatatgtggaagtttccaggaggcctgtcagagcctgaagaagatattggagacacagcggttcgagaagtttttgaagagactggtataaaatcagaattcaggtccgtcctgagtattcggcaacagcacacaaatcctggagcttttgggaagtcagatatgtatatcatctgccgcctaaagccatattcattcaccataaatttttgccaggaagaatgcttaagatgtgagtggatggatctcaatgacctggcgaagactgaaaatacaactcccatcaccagcagagttgctaggctgctgctgtatgggtacagagaagggtttgacaaaattgacctgactgtggaagaacttccagcagtttacacaggactgttttataaactctatcataaggaactgccagagaattataaaactatgaaaggaattgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nudix (nucleoside diphosphate linked moiety X)-type motif 9 - megalencephalic leukoencephalopathy with subcortical cysts 1 - phosphatidylinositol-5-phosphate 4-kinase, type II, alpha - ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) |