Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PNCK-pregnancy up-regulated non-ubiquitously expressed CaM kinase Gene
PTXBC033746
New product
Data sheet of PNCK-pregnancy up-regulated non-ubiquitously expressed CaM kinase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PNCK-pregnancy up-regulated non-ubiquitously expressed CaM kinase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033746 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PNCK |
| Origin species: | Human |
| Product name: | PNCK-pregnancy up-regulated non-ubiquitously expressed CaM kinase Gene |
| Size: | 2ug |
| Accessions: | BC033746 |
| Gene id: | 139728 |
| Gene description: | pregnancy up-regulated non-ubiquitously expressed CaM kinase |
| Synonyms: | BSTK3; CaMK1b; calcium/calmodulin-dependent protein kinase type 1B; caM kinase I beta; caM kinase IB; caM-KI beta; caMKI-beta; pregnancy up-regulated non-ubiquitously-expressed CaM kinase; pregnancy upregulated non-ubiquitously expressed CaM kinase; pregnancy up-regulated nonubiquitous CaM kinase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgctgctgaagaaacacacggaggacatcagcagcgtctacgagatccgcgagaggctcggctcggggccctccccgctccactctctctccctcctgcctctcctctcttcccacttccttcccacctcccaccgccccgtctgcggcaggggtgccttctccgaggtggtgctggcccaggagcggggctccgcacacctcgtggccctcaagtgcatccccaagaaggccctccggggcaaggaggccctggtggagaacgagatcgcagtgctccgtaggatcagtcaccccaacatcgtcgctctggaggatgtccacgagagcccttcccacctctacctggccatggaactgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) - ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) - nudix (nucleoside diphosphate linked moiety X)-type motif 6 - nudix (nucleoside diphosphate linked moiety X)-type motif 9 |