PNCK-pregnancy up-regulated non-ubiquitously expressed CaM kinase Gene View larger

PNCK-pregnancy up-regulated non-ubiquitously expressed CaM kinase Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PNCK-pregnancy up-regulated non-ubiquitously expressed CaM kinase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PNCK-pregnancy up-regulated non-ubiquitously expressed CaM kinase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033746
Product type: DNA & cDNA
Ncbi symbol: PNCK
Origin species: Human
Product name: PNCK-pregnancy up-regulated non-ubiquitously expressed CaM kinase Gene
Size: 2ug
Accessions: BC033746
Gene id: 139728
Gene description: pregnancy up-regulated non-ubiquitously expressed CaM kinase
Synonyms: BSTK3; CaMK1b; calcium/calmodulin-dependent protein kinase type 1B; caM kinase I beta; caM kinase IB; caM-KI beta; caMKI-beta; pregnancy up-regulated non-ubiquitously-expressed CaM kinase; pregnancy upregulated non-ubiquitously expressed CaM kinase; pregnancy up-regulated nonubiquitous CaM kinase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctgctgaagaaacacacggaggacatcagcagcgtctacgagatccgcgagaggctcggctcggggccctccccgctccactctctctccctcctgcctctcctctcttcccacttccttcccacctcccaccgccccgtctgcggcaggggtgccttctccgaggtggtgctggcccaggagcggggctccgcacacctcgtggccctcaagtgcatccccaagaaggccctccggggcaaggaggccctggtggagaacgagatcgcagtgctccgtaggatcagtcaccccaacatcgtcgctctggaggatgtccacgagagcccttcccacctctacctggccatggaactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)
- ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast)
- nudix (nucleoside diphosphate linked moiety X)-type motif 6
- nudix (nucleoside diphosphate linked moiety X)-type motif 9

Buy PNCK-pregnancy up-regulated non-ubiquitously expressed CaM kinase Gene now

Add to cart