IFIT3-interferon-induced protein with tetratricopeptide repeats 3 Gene View larger

IFIT3-interferon-induced protein with tetratricopeptide repeats 3 Gene

PTXBC001383

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFIT3-interferon-induced protein with tetratricopeptide repeats 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IFIT3-interferon-induced protein with tetratricopeptide repeats 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001383
Product type: DNA & cDNA
Ncbi symbol: IFIT3
Origin species: Human
Product name: IFIT3-interferon-induced protein with tetratricopeptide repeats 3 Gene
Size: 2ug
Accessions: BC001383
Gene id: 3437
Gene description: interferon-induced protein with tetratricopeptide repeats 3
Synonyms: CIG-49; GARG-49; IFI60; IFIT4; IRG2; ISG60; P60; RIG-G; cig41; interferon-induced protein with tetratricopeptide repeats 3; CIG49; IFI-60K; IFIT-3; IFIT-4; ISG-60; interferon-induced 60 kDa protein; interferon-induced protein with tetratricopeptide repeats 4; retinoic acid-induced gene G protein; interferon induced protein with tetratricopeptide repeats 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgaggtcaccaagaattccctggagaaaatccttccacagctgaaatgccatttcacctggaacttattcaaggaagacagtgtctcaagggatctagaagatagagtgtgtaaccagattgaatttttaaacactgagttcaaagctacaatgtacaacttgttggcctacataaaacacctagatggtaacaacgaggcagccctggaatgcttacggcaagctgaagagttaatccagcaagaacatgctgaccaagcagaaatcagaagtctagtcacttggggaaactacgcctgggtctactatcacttgggcagactctcagatgctcagatttatgtagataaggtgaaacaaacctgcaagaaattttcaaatccatacagtattgagtattctgaacttgactgtgaggaagggtggacacaactgaagtgtggaagaaatgaaagggcgaaggtgtgttttgagaaggctctggaagaaaagcccaacaacccagaattctcctctggactggcaattgcgatgtaccatctggataatcacccagagaaacagttctctactgatgttttgaagcaggccattgagctgagtcctgataaccaatacgtcaaggttctcttgggcctgaaactgcagaagatgaataaagaagctgaaggagagcagtttgttgaagaagccttggaaaagtctccttgccaaacagatgtcctccgcagtgcagccaaattttacagaagaaaaggtgacctagacaaagctattgaactgtttcaacgggtgttggaatccacaccaaacaatggctacctctatcaccagattgggtgctgctacaaggcaaaagtaagacaaatgcagaatacaggagaatctgaagctagtggaaataaagagatgattgaagcactaaagcaatatgctatggactattcgaataaagctcttgagaagggactgaatcctctgaatgcatactccgatctcgctgagttcctggagacggaatgttatcagacaccattcaataaggaagtccctgatgctgaaaagcaacaatcccatcagcgctactgcaaccttcagaaatataatgggaagtctgaagacactgctgtgcaacatggtttagagggtttgtccataagcaaaaaatcaactgacaaggaagagatcaaagaccaaccacagaatgtatctgaaaatctgcttccacaaaatgcaccaaattattggtatcttcaaggattaattcataagcagaatggagatctgctgcaagcagccaaatgttatgagaaggaactgggccgcctgctaagggatgccccttcaggcataggcagtattttcctgtcagcatctgagcttgaggatggtagtgaggaaatgggccagggcgcagtcagctccagtcccagagagctcctctctaactcagagcaactgaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - small nuclear RNA activating complex, polypeptide 5, 19kDa
- glycerophosphodiester phosphodiesterase domain containing 5
- TIP41, TOR signaling pathway regulator-like (S. cerevisiae)
- v-rel reticuloendotheliosis viral oncogene homolog A (avian)

Buy IFIT3-interferon-induced protein with tetratricopeptide repeats 3 Gene now

Add to cart