SGK1-serum/glucocorticoid regulated kinase 1 Gene View larger

SGK1-serum/glucocorticoid regulated kinase 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SGK1-serum/glucocorticoid regulated kinase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SGK1-serum/glucocorticoid regulated kinase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001263
Product type: DNA & cDNA
Ncbi symbol: SGK1
Origin species: Human
Product name: SGK1-serum/glucocorticoid regulated kinase 1 Gene
Size: 2ug
Accessions: BC001263
Gene id: 6446
Gene description: serum/glucocorticoid regulated kinase 1
Synonyms: Sgk1 variant i3; serine/threonine-protein kinase Sgk1; SGK; serine/threonine protein kinase SGK; serum/glucocorticoid regulated kinase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacggtgaaaactgaggctgctaagggcaccctcacttactccaggatgaggggcatggtggcaattctcatcgctttcatgaagcagaggaggatgggtctgaacgactttattcagaagattgccaataactcctatgcatgcaaacaccctgaagttcagtccatcttgaagatctcccaacctcaggagcctgagcttatgaatgccaacccttctcctccaccaagtccttctcagcaaatcaaccttggcccgtcgtccaatcctcatgctaaaccatctgactttcacttcttgaaagtgatcggaaagggcagttttggaaaggttcttctagcaagacacaaggcagaagaagtgttctatgcagtcaaagttttacagaagaaagcaatcctgaaaaagaaagaggagaagcatattatgtcggagcggaatgttctgttgaagaatgtgaagcaccctttcctggtgggccttcacttctctttccagactgctgacaaattgtactttgtcctagactacattaatggtggagagttgttctaccatctccagagggaacgctgcttcctggaaccacgggctcgtttctatgctgctgaaatagccagtgccttgggctacctgcattcactgaacatcgtttatagagacttaaaaccagagaatattttgctagattcacagggacacattgtccttactgacttcggactctgcaaggagaacattgaacacaacagcacaacatccaccttctgtggcacgccggagtatctcgcacctgaggtgcttcataagcagccttatgacaggactgtggactggtggtgcctgggagctgtcttgtatgagatgctgtatggcctgccgcctttttatagccgaaacacagctgaaatgtacgacaacattctgaacaagcctctccagctgaaaccaaatattacaaattccgcaagacacctcctggagggcctcctgcagaaggacaggacaaagcggctcggggccaaggatgacttcatggagattaagagtcatgtcttcttctccttaattaactgggatgatctcattaataagaagattactcccccttttaacccaaatgtgagtgggcccaacgacctacggcactttgaccccgagtttaccgaagagcctgtccccaactccattggcaagtcccctgacagcgtcctcgtcacagccagcgtcaaggaagctgccgaggctttcctaggcttttcctatgcgcctcccacggactctttcctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - non-SMC condensin I complex, subunit G
- chromosome 1 open reading frame 103
- sulfide quinone reductase-like (yeast)
- chromosome 20 open reading frame 54

Buy SGK1-serum/glucocorticoid regulated kinase 1 Gene now

Add to cart