C1orf103-chromosome 1 open reading frame 103 Gene View larger

C1orf103-chromosome 1 open reading frame 103 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf103-chromosome 1 open reading frame 103 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf103-chromosome 1 open reading frame 103 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008115
Product type: DNA & cDNA
Ncbi symbol: C1orf103
Origin species: Human
Product name: C1orf103-chromosome 1 open reading frame 103 Gene
Size: 2ug
Accessions: BC008115
Gene id: 55791
Gene description: chromosome 1 open reading frame 103
Synonyms: C1orf103; RIF1; ligand-dependent nuclear receptor-interacting factor 1; receptor-interacting factor 1; ligand dependent nuclear receptor interacting factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaccattgagtaccatcgatcctagtgggacgcgatccaaaaatatgcctattaaagataatgctttggttatgtttaatgggaaagtctatctgttggctaaaaaggggacagatgttctgccatcacaaattgaccaacagaattctgtttctcctgatactccagtaagaaaagacacgttacagacagtgagttcaagtccagtcacagaaatatccagagaggttgtaaatattgttttggctaaaagtaaatcttcccagatggagacaaaatcactttccaatacccagcttgcttccatggccaatctaagggcagagaagaataaagtggagaaaccatctccttctaccacaaatccacatatgaaccaatccagtaactacttaaaacagagtaagactttattcacaaatccaatctttccagttggatttagtacaggacacaatgcccccagaaaagtaacagccgtcatttatgctagaaaaggaagtgtcctccagagcatagagaaaataagttcctctgttgatgcaacaactgttacttcacaacagtgtgttttcagagaccaagaaccaaagatccataatgagatggcatcaacatcagataaaggtgcccaaggaagaaatgacaagaaagattctcaaggaagaagtaataaggcattacatctgaagagtgatgctgaatttaaaaagatatttggccttactaaggatttgagagtgtgccttactcgaattcctgaccatttgacctctggagaaggtttcgattcctttagcagtttggtaaagagtggtacttacaaagagacagagtttatggtgaaggaaggagagagaaaacagcagaattttgataagaaaagaaaagcaaaaactaataagaagatggatcacataaagaagagaaaaacagagaatgcttataacgcaatcataaatggggaagctaatgtcaccggttcccaactcctaagcagtattttaccaacttcagatgtgtcacaacataacattctcacgagtcacagcaaaaccagacaagaaaagagaactgagatggaatactatacccatgagaagcaagagaaaggcactttgaattcaaatgcagcttatgaacaaagtcatttcttcaataaaaattataccgaagatattttcccagtgacaccaccggagttagaagaaaccattcgagatgaaaaaataagaagacttaagcaggtgctgagagagaaagaagcagctcttgaagaaatgcgtaagaagatgcaccaaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sulfide quinone reductase-like (yeast)
- chromosome 20 open reading frame 54
- GTP binding protein 3 (mitochondrial)
- GTP binding protein 3 (mitochondrial)

Buy C1orf103-chromosome 1 open reading frame 103 Gene now

Add to cart