SQRDL-sulfide quinone reductase-like (yeast) Gene View larger

SQRDL-sulfide quinone reductase-like (yeast) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SQRDL-sulfide quinone reductase-like (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SQRDL-sulfide quinone reductase-like (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016836
Product type: DNA & cDNA
Ncbi symbol: SQRDL
Origin species: Human
Product name: SQRDL-sulfide quinone reductase-like (yeast) Gene
Size: 2ug
Accessions: BC016836
Gene id: 58472
Gene description: sulfide quinone reductase-like (yeast)
Synonyms: CGI-44; PRO1975; SQOR; sulfide:quinone oxidoreductase, mitochondrial; sulfide dehydrogenase like; sulfide quinone reductase-like (yeast)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgccactggtggctgtggtatcagggccccgtgcccagctctttgcctgcctgctcaggctgggcactcagcaggtcggcccccttcagctgcacaccggggccagccatgcggccaggaaccattatgaggtgctggtgctgggtgggggcagtggcggaatcaccatggctgcccgcatgaagaggaaagtgggtgcagagaatgtggccattgttgagcccagtgagagacatttctaccagccaatctggacactggtgggtgctggtgccaaacaattgtcctcatctggtcgtcccacggcaagtgtgattccatctggtgtagaatggatcaaagctagagtgactgagttgaacccagacaagaactgcattcacacagatgacgacgagaagatctcctaccgatatcttattattgctctcggaatccagctggactatgagaagattaaaggcctacctgaaggtttcgctcatcccaaaatagggtcgaattattcagttaagactgtagagaagacatggaaagctctgcaggacttcaaagagggcaatgccatcttcaccttcccaaatactccagtgaagtgtgctggagcccctcagaagatcatgtacttatcagaagcctacttcaggaagacagggaagcgatccaaggccaatatcattttcaacacttctcttggagccattttcggggttaagaagtatgcagatgccctgcaggagatcatccaggagcggaacctcactgttaactacaagaaaaacctcattgaagtccgagccgataaacaagaggctgtatttgagaacctggacaaaccaggagagacccaagtgatttcatatgaaatgcttcatgtcacacctccaatgagcccaccagatgtcctcaagaccagtcctgtggctgatgctgctggttgggtggatgtggataaagaaactctgcaacacaggaggtacccaaatgtgtttgggattggggactgcaccaaccttcctacgtcaaagaccgctgctgcagtagctgcccagtcaggaatacttgataggacaatttctgtaattatgaagaatcaaacaccaacaaagaagtatgatggctacacatcatgtccactggtgaccggctacaaccgtgtgattcttgctgagtttgactacaaagcagagccgctagaaaccttcccctttgatcaaagcaaagagcgcctttccatgtatctcatgaaagctgacctgatgcctttcctgtattggaatatgatgctaaggggttactggggaggaccagcgtttctgcgcaagttgtttcatctaggtatgagttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 20 open reading frame 54
- GTP binding protein 3 (mitochondrial)
- GTP binding protein 3 (mitochondrial)
- chromosome 22 open reading frame 28

Buy SQRDL-sulfide quinone reductase-like (yeast) Gene now

Add to cart