C20orf54-chromosome 20 open reading frame 54 Gene View larger

C20orf54-chromosome 20 open reading frame 54 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf54-chromosome 20 open reading frame 54 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf54-chromosome 20 open reading frame 54 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009750
Product type: DNA & cDNA
Ncbi symbol: C20orf54
Origin species: Human
Product name: C20orf54-chromosome 20 open reading frame 54 Gene
Size: 2ug
Accessions: BC009750
Gene id: 113278
Gene description: chromosome 20 open reading frame 54
Synonyms: C20orf54; BVVLS; BVVLS1; RFT2; RFVT3; bA371L19.1; hRFT2; solute carrier family 52, riboflavin transporter, member 3; riboflavin transporter 2; solute carrier family 52 (riboflavin transporter), member 3; solute carrier family 52 member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccttcctgatgcacctgctggtctgcgtcttcggaatgggctcctgggtgaccatcaatgggctctgggtagagctgcccctgctggtgatggagctgcccgagggctggtacctgccctcctacctcacggtggtcatccagctggccaacatcgggcccctcctggtcaccctgctccatcacttccggcccagctgcctttccgaagtgcccatcatcttcaccctgctgggcgtgggaaccgtcacctgcatcatctttgccttcctctggaatatgacctcctgggtgctggacggccaccacagcatcgctttcttggtcctcaccttcttcctggccctggtggactgcacctcttcagtgaccttcctgccgttcatgagccggctgcccacctactacctcaccaccttctttgtgggtgaaggactcagcggcctcttgcccgccctggtggctcttgcccagggctccggtctcactacctgcgtcaatgtcactgagatatcagacagcgtaccaagccctgtacccacgagggagactgacatcgcacagggagttcccagagctttggtgtccgccctccccggaatggaagcacccttgtcccacctggagagccgctaccttcccgcccacttctcacccctggtcttcttcctcctcctatccatcatgatggcctgctgcctcgtggcgttctttgtcctccagcgtcaacccaggtgctgggaggcttccgtggaagacctcctcaatgaccaggtcaccctccactccatccggctgcgggaagagaatgacttgggccctgcaggcatggtggacagcagccagggccaggggtatctagaggagaaagcagccccctgctgcccggcgcacctggccttcgtctataccctggtggccttcgtcaacgcgctcaccaacggcatgctgccctctgtgcagacctactcctgcctgtcctatgggccagttgcctaccacctggctgccaccctcagcattgtggccaaccctcttgcctcgttggtctccatgttcctgcctaacaggtctctgctgttcctgggggtcctctccgtgcttgggacctgctttgggggctacaacatggccatggcggtgatgagcccctgccccctcttgcagggccactggggtggggaagtcctcattgtggcctcgtgggtgcttttcagcggctgcctcagctacgtcaaggtgatgctgggcgtggtcctgcgcgacctcagccgcagcgccctcttgtggtgcggggcggcggtgcagctgggctcgctgctcggagcgctgctcatgttccctctggtcaacgtgctgcggctcttctcgtccgcggacttctgcaatctgcactgtccagcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GTP binding protein 3 (mitochondrial)
- GTP binding protein 3 (mitochondrial)
- chromosome 22 open reading frame 28
- chromosome 22 open reading frame 28

Buy C20orf54-chromosome 20 open reading frame 54 Gene now

Add to cart