Login to display prices
Login to display prices
C20orf54-chromosome 20 open reading frame 54 Gene View larger

C20orf54-chromosome 20 open reading frame 54 Gene

PTXBC009750

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf54-chromosome 20 open reading frame 54 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf54-chromosome 20 open reading frame 54 Gene

Proteogenix catalog: PTXBC009750
Ncbi symbol: C20orf54
Product name: C20orf54-chromosome 20 open reading frame 54 Gene
Size: 2ug
Accessions: BC009750
Gene id: 113278
Gene description: chromosome 20 open reading frame 54
Synonyms: C20orf54; BVVLS; BVVLS1; RFT2; RFVT3; bA371L19.1; hRFT2; solute carrier family 52, riboflavin transporter, member 3; riboflavin transporter 2; solute carrier family 52 (riboflavin transporter), member 3; solute carrier family 52 member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccttcctgatgcacctgctggtctgcgtcttcggaatgggctcctgggtgaccatcaatgggctctgggtagagctgcccctgctggtgatggagctgcccgagggctggtacctgccctcctacctcacggtggtcatccagctggccaacatcgggcccctcctggtcaccctgctccatcacttccggcccagctgcctttccgaagtgcccatcatcttcaccctgctgggcgtgggaaccgtcacctgcatcatctttgccttcctctggaatatgacctcctgggtgctggacggccaccacagcatcgctttcttggtcctcaccttcttcctggccctggtggactgcacctcttcagtgaccttcctgccgttcatgagccggctgcccacctactacctcaccaccttctttgtgggtgaaggactcagcggcctcttgcccgccctggtggctcttgcccagggctccggtctcactacctgcgtcaatgtcactgagatatcagacagcgtaccaagccctgtacccacgagggagactgacatcgcacagggagttcccagagctttggtgtccgccctccccggaatggaagcacccttgtcccacctggagagccgctaccttcccgcccacttctcacccctggtcttcttcctcctcctatccatcatgatggcctgctgcctcgtggcgttctttgtcctccagcgtcaacccaggtgctgggaggcttccgtggaagacctcctcaatgaccaggtcaccctccactccatccggctgcgggaagagaatgacttgggccctgcaggcatggtggacagcagccagggccaggggtatctagaggagaaagcagccccctgctgcccggcgcacctggccttcgtctataccctggtggccttcgtcaacgcgctcaccaacggcatgctgccctctgtgcagacctactcctgcctgtcctatgggccagttgcctaccacctggctgccaccctcagcattgtggccaaccctcttgcctcgttggtctccatgttcctgcctaacaggtctctgctgttcctgggggtcctctccgtgcttgggacctgctttgggggctacaacatggccatggcggtgatgagcccctgccccctcttgcagggccactggggtggggaagtcctcattgtggcctcgtgggtgcttttcagcggctgcctcagctacgtcaaggtgatgctgggcgtggtcctgcgcgacctcagccgcagcgccctcttgtggtgcggggcggcggtgcagctgggctcgctgctcggagcgctgctcatgttccctctggtcaacgtgctgcggctcttctcgtccgcggacttctgcaatctgcactgtccagcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: