NCAPG-non-SMC condensin I complex, subunit G Gene View larger

NCAPG-non-SMC condensin I complex, subunit G Gene

PTXBC000827

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NCAPG-non-SMC condensin I complex, subunit G Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NCAPG-non-SMC condensin I complex, subunit G Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000827
Product type: DNA & cDNA
Ncbi symbol: NCAPG
Origin species: Human
Product name: NCAPG-non-SMC condensin I complex, subunit G Gene
Size: 2ug
Accessions: BC000827
Gene id: 64151
Gene description: non-SMC condensin I complex, subunit G
Synonyms: CAPG; CHCG; NY-MEL-3; YCG1; condensin complex subunit 3; XCAP-G homolog; chromosome condensation protein G; chromosome-associated protein G; condensin subunit CAP-G; melanoma antigen NY-MEL-3; non-SMC condensin I complex subunit G
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatggaatcatcgaatctttgattcttcctggaataataagtattcatcctgttgtaagaaacctggctgttttatgcttgggatgctgtggactacagaatcaggattttgcaaggaaacacttcgtattactattgcaggttttgcaaattgatgatgtcacaataaaaataagtgctttaaaggcaatctttgaccaactgatgacgttcgggattgaaccatttaaaactaaaaaaatcaaaacacttcattgtgaaggtacagaaataaacagtgatgatgagcaagaatcaaaagaagttgaagagactgctacagctaagaatgttctgaaactcctttctgatttcttagatagtgaggtatctgaacttaggactggagctgcagaaggactagccaagctgatgttctctgggcttttggtcagcagcaggattctttctcgtcttattttgttatggtacaatcctgtgactgaagaggatgttcaacttcgacattgcctaggcgtgttcttccccgtgtttgcttatgcaagcaggactaatcaggaatgctttgaagaagcttttcttccaaccctgcaaacactggccaatgcccctgcatcttctcctttagctgaaattgatatcacaaatgttgctgagttacttgtagatttgacaagaccaagtggattaaatcctcaggccaagacttcccaagattatcaggccttaacagtacatgacaatttggctatgaaaatttgcaatgagatcttaacaagtccgtgctcgccagaaattcgagtctatacaaaagccttgagttctttagaactcagtagccatcttgcaaaagatcttctggttctattgaatgagattctggagcaagtaaaagataggacatgtctgagagctttggagaaaatcaagattcagttagaaaaaggaaataaagaatttggtgaccaagctgaagcagcacaggatgccaccttgactacaactactttccaaaatgaagatgaaaagaataaagaagtatatatgactccactcaggggtgtaaaagcaacccaagcatcaaagtctactcagctaaagactaacagaggacagagaaaagtgacagtttcagctaggacgaacaggaggtgtcagactgctgaagccgactctgaaagtgatcatgaagttccagaaccagaatcagaaatgaagatgagactaccaagacgagccaaaaccgcagcactagaaaaaagtaaacttaaccttgcccaatttctcaatgaagatctaagttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 103
- sulfide quinone reductase-like (yeast)
- chromosome 20 open reading frame 54
- GTP binding protein 3 (mitochondrial)

Buy NCAPG-non-SMC condensin I complex, subunit G Gene now

Add to cart