KCNQ2-potassium voltage-gated channel, KQT-like subfamily, member 2 Gene View larger

KCNQ2-potassium voltage-gated channel, KQT-like subfamily, member 2 Gene

PTXBC000699

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNQ2-potassium voltage-gated channel, KQT-like subfamily, member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCNQ2-potassium voltage-gated channel, KQT-like subfamily, member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000699
Product type: DNA & cDNA
Ncbi symbol: KCNQ2
Origin species: Human
Product name: KCNQ2-potassium voltage-gated channel, KQT-like subfamily, member 2 Gene
Size: 2ug
Accessions: BC000699
Gene id: 3785
Gene description: potassium voltage-gated channel, KQT-like subfamily, member 2
Synonyms: BFNC; EBN; EBN1; ENB1; HNSPC; KCNA11; KV7.2; potassium voltage-gated channel subfamily KQT member 2; neuroblastoma-specific potassium channel subunit alpha KvLQT2; potassium channel, voltage gated KQT-like subfamily Q, member 2; voltage-gated potassium channel subunit Kv7.2; potassium voltage-gated channel subfamily Q member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcagaagtcgcgcaacggcggcgtataccccggcccgagcggggagaagaagctgaaggtgggcttcgtggggctggaccccggcgcgcccgactccacccgggacggggcgctgctgatcgccggctccgaggcccccaagcgcggcagcatcctcagcaaacctcgcgcgggcggcgcgggcgccgggaagccccccaagcgcaacgccttctaccgcaagctgcagaatttcctctacaacgtgctggagcggccgcgcggctgggcgttcatctaccacgcctacgtgttcctcctggttttctcctgcctcgtgctgtctgtgttttccaccatcaaggagtatgagaagagctcggagggggccctctacatcctggaaatcgtgactatcgtggtgtttggcgtggagtacttcgtgcggatctgggccgcaggctgctgctgccggtaccgtggctggagggggcggctcaagtttgcccggaaaccgttctgtgtgattgacatcatggtgctcatcgcctccattgcggtgctggccgccggctcccagggcaacgtctttgccacatctgcgctccggagcctgcgcttcctgcagattctgcggatgatccgcatggaccggcggggaggcacctggaagctgctgggctctgtggtctatgcccacagcaaggagctggtcactgcctggtacatcggcttcctttgtctcatcctggcctcgttcctggtgtacttggcagagaagggggagaacgaccactttgacacctacgcggatgcactctggtggggcctgatcacgctgaccaccattggctacggggacaagtacccccagacctggaacggcaggctccttgcggcaaccttcaccctcatcggtgtctccttcttcgcgctgcctgcaggcatcttggggtctgggtttgccctgaaggttcaggagcagcacaggcagaagcactttgagaagaggcggaacccggcagcaggcctgatccagtcggcctggagattctacgccaccaacctctcgcgcacagacctgcactccacgtggcagtactacgagcgaacggtcaccgtgcccatgtacaggtaccgccgccgggcacctgccaccaagcaactgtttcattttttattttccatttgttcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - translocase of outer mitochondrial membrane 6 homolog (yeast)
- formation of mitochondrial complexes 1 homolog (S. cerevisiae)
- NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
- mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)

Buy KCNQ2-potassium voltage-gated channel, KQT-like subfamily, member 2 Gene now

Add to cart