Login to display prices
Login to display prices
TSEN34-tRNA splicing endonuclease 34 homolog (S. cerevisiae) Gene View larger

TSEN34-tRNA splicing endonuclease 34 homolog (S. cerevisiae) Gene

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSEN34-tRNA splicing endonuclease 34 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TSEN34-tRNA splicing endonuclease 34 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000944
Product type: DNA & cDNA
Ncbi symbol: TSEN34
Origin species: Human
Product name: TSEN34-tRNA splicing endonuclease 34 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC000944
Gene id: 79042
Gene description: tRNA splicing endonuclease 34 homolog (S. cerevisiae)
Synonyms: TSEN34 tRNA splicing endonuclease subunit; LENG5; PCH2C; SEN34; SEN34L; tRNA-splicing endonuclease subunit Sen34; CTD-3093M3.1; hsSen34; leukocyte receptor cluster (LRC) member 5; leukocyte receptor cluster member 5; tRNA-intron endonuclease Sen34; tRNA splicing endonuclease subunit 34
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggtggtggaggtggcgaacggccgctccctggtgtggggagccgaggcggtgcaggccctccgggagcgcctgggtgtggggggccgcacggtaggcgccctgccccgcgggccccgccagaactcgcgcctgggcctcccgctgctgctgatgcccgaagaggcgcggctcttggccgagatcggcgccgtgactctggtcagcgccccgcgtccagactctcggcaccacagcctggccctgacatccttcaagcgccagcaagaggagagcttccaggagcagagcgccttggcagctgaggcccgggagacccgtcgtcaggaggtcctggagaagattacggagggccaggctgctaagaagcagaaactagaacaggcttcaggggccagctcaagccaggaggccggctcgagccaggctgccaaagaggatgagaccagtgatggccaggcttcgggagagcaggaggaagctggcccctcgtcttcccaagcaggaccctcaaatggggtagcccccttgcccagatctgctctccttgtccagctggccactgccaggcctcgaccggtcaaggccaggcccctggactggcgtgtccagtctaaagactggccccacgccggccgccctgcccacgagctgcgctacagtatctacagagacctgtgggagcgaggcttcttcctcagtgcggctggcaagttcggaggtgacttcctggtctatcctggtgaccccctccgcttccacgcccattatatcgctcagtgctgggcccctgaggacacctcccactccaagacctggttgctgctgggcgccttggaaccagcgtcagaaagaccctgctcctctgttctccgcagcctgatggtaaggtggtctacacctccctgcaatgggccagcctgcagtgaactccagagacctaggggatgtggctgtgtcggcagcaagagcctttctggatgttccccagctcttctctgggagtctagaacatcctcctacctttctccgcggttagtttttgattccaggttttcgaacactacatcttttttatgttcttccttgtttcaaagcacttattggctgtgtttttgtagttacctattttcacactgtgagcttcccgagaatggggcctgggtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RGP1 retrograde golgi transport homolog (S. cerevisiae)
- Bernardinelli-Seip congenital lipodystrophy 2 (seipin)
- proteasome (prosome, macropain) 26S subunit, ATPase, 1
- NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa