Login to display prices
Login to display prices
NDUFV1-NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa Gene View larger

NDUFV1-NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa Gene

PTXBC008146

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFV1-NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFV1-NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa Gene

Proteogenix catalog: PTXBC008146
Ncbi symbol: NDUFV1
Product name: NDUFV1-NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa Gene
Size: 2ug
Accessions: BC008146
Gene id: 4723
Gene description: NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
Synonyms: CI-51K; CI51KD; UQOR1; NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial; NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa; NADH-ubiquinone oxidoreductase 51 kDa subunit; complex I 51 kda subunit; complex I 51kDa subunit; complex I, mitochondrial respiratory chain; mitochondrial NADH dehydrogenase ubiquinone flavoprotein 1; mitochondrial NADH:ubiquinone oxidoreductase 51 kda subunit; NADH:ubiquinone oxidoreductase core subunit V1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggcaacacggcggctgctcggctggtcgcttcccgcgcggacagcacccaagaaaacctcatttggctcgctgaaggatgaagaccggattttcaccaacctgtacggccgccatgactggaggctgaaaggttccctgagtcgaggtgactggtacaagacaaaggagatcctgctgaaggggcccgactggatcctgggcgagatcaagacatcgggtttgaggggccgtggaggcgctggcttccccactggcctcaagtggagcttcatgaataagccctcagatggcaggcccaagtatctggtggtgaacgcagacgagggggagccgggcacctgcaaggaccgggagatcttacgccatgatcctcacaagctgctggaaggctgcctggtggggggccgggccatgggcgcccgcgctgcctatatctacatccgaggggaattctacaatgaggcctccaatctgcaggtggccatccgagaggcctatgaggcaggtctgattggcaagaatgcttgtggctctggctatgattttgacgtgtttgtggtgcgcggggctggggcctacatctgtggagaggagacagcgctcatcgagtccattgagggcaagcagggcaagccccgcctgaagccccccttccccgcagacgtgggagtgtttggctgccccacaactgtggccaacgtggagacagtggcagtgtcccccacaatctgccgccgtggaggtacctggtttgctggctttggcagagaacgcaactcaggcaccaaactattcaacatctctggccatgtcaaccacccttgcactgtggaggaggagatgtctgtgcccttgaaagaactgattgagaagcatgctgggggtgtcacgggcggctgggacaacctccttgctgtgatccctggcggctcgtctaccccactgatccccaagtctgtgtgtgagacggtgctgatggacttcgatgcgctggtgcaggcacagacaggcctgggcacagctgcggtgatcgtcatggaccgctcgacggacatcgtgaaagccatcgcccgcctcattgagttctataagcacgagagctgtggccagtgtaccccatgccgtgagggtgtggactggatgaacaaggtgatggcacgtttcgtgaggggggatgcccggccggccgagatcgactccctgtgggagatcagcaagcagatagaaggccatacgatttgtgctctgggtgacggggccgcctggcctgtgcagggtctgatccgccactttcggccggagctcgaggagcggatgcagcggtttgcccagcagcatcaggcccggcaggctgcctcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: