NDUFV1-NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa Gene View larger

NDUFV1-NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFV1-NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFV1-NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008146
Product type: DNA & cDNA
Ncbi symbol: NDUFV1
Origin species: Human
Product name: NDUFV1-NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa Gene
Size: 2ug
Accessions: BC008146
Gene id: 4723
Gene description: NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
Synonyms: CI-51K; CI51KD; UQOR1; NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial; NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa; NADH-ubiquinone oxidoreductase 51 kDa subunit; complex I 51 kda subunit; complex I 51kDa subunit; complex I, mitochondrial respiratory chain; mitochondrial NADH dehydrogenase ubiquinone flavoprotein 1; mitochondrial NADH:ubiquinone oxidoreductase 51 kda subunit; NADH:ubiquinone oxidoreductase core subunit V1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggcaacacggcggctgctcggctggtcgcttcccgcgcggacagcacccaagaaaacctcatttggctcgctgaaggatgaagaccggattttcaccaacctgtacggccgccatgactggaggctgaaaggttccctgagtcgaggtgactggtacaagacaaaggagatcctgctgaaggggcccgactggatcctgggcgagatcaagacatcgggtttgaggggccgtggaggcgctggcttccccactggcctcaagtggagcttcatgaataagccctcagatggcaggcccaagtatctggtggtgaacgcagacgagggggagccgggcacctgcaaggaccgggagatcttacgccatgatcctcacaagctgctggaaggctgcctggtggggggccgggccatgggcgcccgcgctgcctatatctacatccgaggggaattctacaatgaggcctccaatctgcaggtggccatccgagaggcctatgaggcaggtctgattggcaagaatgcttgtggctctggctatgattttgacgtgtttgtggtgcgcggggctggggcctacatctgtggagaggagacagcgctcatcgagtccattgagggcaagcagggcaagccccgcctgaagccccccttccccgcagacgtgggagtgtttggctgccccacaactgtggccaacgtggagacagtggcagtgtcccccacaatctgccgccgtggaggtacctggtttgctggctttggcagagaacgcaactcaggcaccaaactattcaacatctctggccatgtcaaccacccttgcactgtggaggaggagatgtctgtgcccttgaaagaactgattgagaagcatgctgggggtgtcacgggcggctgggacaacctccttgctgtgatccctggcggctcgtctaccccactgatccccaagtctgtgtgtgagacggtgctgatggacttcgatgcgctggtgcaggcacagacaggcctgggcacagctgcggtgatcgtcatggaccgctcgacggacatcgtgaaagccatcgcccgcctcattgagttctataagcacgagagctgtggccagtgtaccccatgccgtgagggtgtggactggatgaacaaggtgatggcacgtttcgtgaggggggatgcccggccggccgagatcgactccctgtgggagatcagcaagcagatagaaggccatacgatttgtgctctgggtgacggggccgcctggcctgtgcagggtctgatccgccactttcggccggagctcgaggagcggatgcagcggtttgcccagcagcatcaggcccggcaggctgcctcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
- Bernardinelli-Seip congenital lipodystrophy 2 (seipin)
- NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa
- inositol polyphosphate-4-phosphatase, type II, 105kDa

Buy NDUFV1-NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa Gene now

Add to cart