Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
INPP4B-inositol polyphosphate-4-phosphatase, type II, 105kDa Gene
PTXBC005273
New product
Data sheet of INPP4B-inositol polyphosphate-4-phosphatase, type II, 105kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about INPP4B-inositol polyphosphate-4-phosphatase, type II, 105kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005273 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | INPP4B |
| Origin species: | Human |
| Product name: | INPP4B-inositol polyphosphate-4-phosphatase, type II, 105kDa Gene |
| Size: | 2ug |
| Accessions: | BC005273 |
| Gene id: | 8821 |
| Gene description: | inositol polyphosphate-4-phosphatase, type II, 105kDa |
| Synonyms: | type II inositol 3,4-bisphosphate 4-phosphatase; inositol polyphosphate 4-phosphatase II; 4-phosphatase II; inositol polyphosphate-4-phosphatase, type II, 105kDa; inositol polyphosphate-4-phosphatase type II B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaattaaagaggaaggggcatcagaagaagggcagcactttcttcctacagcccaggccaatgatcccggggactgtcagttcacaagtatccagaagactccaaatgaaccgcagttggaattcatccttgatttgaatcaagaattaagagattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), gamma 3 - rho/rac guanine nucleotide exchange factor (GEF) 18 - fibroblast growth factor 7 (keratinocyte growth factor) - microtubule-associated protein 1 light chain 3 beta |