Login to display prices
Login to display prices
INPP4B-inositol polyphosphate-4-phosphatase, type II, 105kDa Gene View larger

INPP4B-inositol polyphosphate-4-phosphatase, type II, 105kDa Gene

PTXBC005273

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of INPP4B-inositol polyphosphate-4-phosphatase, type II, 105kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about INPP4B-inositol polyphosphate-4-phosphatase, type II, 105kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005273
Product type: DNA & cDNA
Ncbi symbol: INPP4B
Origin species: Human
Product name: INPP4B-inositol polyphosphate-4-phosphatase, type II, 105kDa Gene
Size: 2ug
Accessions: BC005273
Gene id: 8821
Gene description: inositol polyphosphate-4-phosphatase, type II, 105kDa
Synonyms: type II inositol 3,4-bisphosphate 4-phosphatase; inositol polyphosphate 4-phosphatase II; 4-phosphatase II; inositol polyphosphate-4-phosphatase, type II, 105kDa; inositol polyphosphate-4-phosphatase type II B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaattaaagaggaaggggcatcagaagaagggcagcactttcttcctacagcccaggccaatgatcccggggactgtcagttcacaagtatccagaagactccaaatgaaccgcagttggaattcatccttgatttgaatcaagaattaagagattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - guanine nucleotide binding protein (G protein), gamma 3
- rho/rac guanine nucleotide exchange factor (GEF) 18
- fibroblast growth factor 7 (keratinocyte growth factor)
- microtubule-associated protein 1 light chain 3 beta