Login to display prices
Login to display prices
MAP1LC3B-microtubule-associated protein 1 light chain 3 beta Gene View larger

MAP1LC3B-microtubule-associated protein 1 light chain 3 beta Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAP1LC3B-microtubule-associated protein 1 light chain 3 beta Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAP1LC3B-microtubule-associated protein 1 light chain 3 beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018634
Product type: DNA & cDNA
Ncbi symbol: MAP1LC3B
Origin species: Human
Product name: MAP1LC3B-microtubule-associated protein 1 light chain 3 beta Gene
Size: 2ug
Accessions: BC018634
Gene id: 81631
Gene description: microtubule-associated protein 1 light chain 3 beta
Synonyms: MAP1LC3B-a; ATG8F; LC3B; MAP1A/1BLC3; microtubule-associated proteins 1A/1B light chain 3B; MAP1 light chain 3-like protein 2; MAP1A/MAP1B LC3 B; MAP1A/MAP1B light chain 3 B; autophagy-related ubiquitin-like modifier LC3 B; microtubule associated protein 1 light chain 3 beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgtcggagaagaccttcaagcagcgccgcaccttcgaacaaagagtagaagatgtccgacttattcgagagcagcatccaaccaaaatcccggtgataatagaacgatacaagggtgagaagcagcttcctgttctggataaaacaaagttccttgtacctgaccatgtcaacatgagtgagctcatcaagataattagaaggcgcttacagctcaatgctaatcaggccttcttcctgttggtgaacggacacagcatggtcagcgtctccacaccaatctcagaggtgtatgagagtgagaaagatgaagatggattcctgtacatggtctatgcctcccaggagacgttcgggatgaaattgtcagtgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ADP-ribosylation-like factor 6 interacting protein 5
- ADP-ribosylation-like factor 6 interacting protein 4
- THAP domain containing, apoptosis associated protein 2
- proteasome (prosome, macropain) subunit, alpha type, 3