ARL6IP5-ADP-ribosylation-like factor 6 interacting protein 5 Gene View larger

ARL6IP5-ADP-ribosylation-like factor 6 interacting protein 5 Gene

PTXBC005143

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARL6IP5-ADP-ribosylation-like factor 6 interacting protein 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARL6IP5-ADP-ribosylation-like factor 6 interacting protein 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005143
Product type: DNA & cDNA
Ncbi symbol: ARL6IP5
Origin species: Human
Product name: ARL6IP5-ADP-ribosylation-like factor 6 interacting protein 5 Gene
Size: 2ug
Accessions: BC005143
Gene id: 10550
Gene description: ADP-ribosylation-like factor 6 interacting protein 5
Synonyms: DERP11; GTRAP3-18; HSPC127; JWA; PRAF3; Yip6b; addicsin; hp22; jmx; PRA1 family protein 3; ADP-ribosylation factor GTPase 6 interacting protein 5; ADP-ribosylation factor-like 6 interacting protein 5; ADP-ribosylation factor-like protein 6-interacting protein 5; ADP-ribosylation-like factor 6 interacting protein 5; ARL-6-interacting protein 5; JM5; PRA1 domain family 3; aip-5; cytoskeleton-related vitamin A-responsive protein; dermal papilla derived protein 11; glutamate transporter EAAC1-interacting protein; glutamate transporter EEAC1-associated protein; prenylated Rab acceptor protein 2; protein JWa; ADP ribosylation factor like GTPase 6 interacting protein 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgttaatatcgccccactccgcgcctgggacgatttcttcccgggttccgatcgctttgcccggccggacttcagggacatttccaaatggaacaaccgcgtagtgagcaacctgctctattaccagaccaactacctggtggtggctgccatgatgatttccattgtggggtttctgagtcccttcaacatgatcctgggaggaatcgtggtggtgctggtgttcacagggtttgtgtgggcagcccacaataaagacgtccttcgccggatgaagaagcgctaccccacgacgttcgttatggtggtcatgttggcgagctatttccttatctccatgtttggaggagtcatggtctttgtgtttggcattacttttcctttgctgttgatgtttatccatgcatcgttgagacttcggaacctcaagaacaaactggagaataaaatggaaggaataggtttgaagaggacaccgatgggcattgtcctggatgccctagaacagcaggaagaaggcatcaacagactcactgactatatcagcaaagtgaaggaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ADP-ribosylation-like factor 6 interacting protein 4
- THAP domain containing, apoptosis associated protein 2
- proteasome (prosome, macropain) subunit, alpha type, 3
- proteasome (prosome, macropain) subunit, alpha type, 4

Buy ARL6IP5-ADP-ribosylation-like factor 6 interacting protein 5 Gene now

Add to cart