GNG3-guanine nucleotide binding protein (G protein), gamma 3 Gene View larger

GNG3-guanine nucleotide binding protein (G protein), gamma 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNG3-guanine nucleotide binding protein (G protein), gamma 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GNG3-guanine nucleotide binding protein (G protein), gamma 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015563
Product type: DNA & cDNA
Ncbi symbol: GNG3
Origin species: Human
Product name: GNG3-guanine nucleotide binding protein (G protein), gamma 3 Gene
Size: 2ug
Accessions: BC015563
Gene id: 2785
Gene description: guanine nucleotide binding protein (G protein), gamma 3
Synonyms: guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-3; NBP gamma-3; guanine nucleotide binding protein (G protein), gamma 3; guanine nucleotide-binding protein gamma-3 subunit; G protein subunit gamma 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaaggtgagaccccggtgaacagcactatgagtattgggcaagcacgcaagatggtggaacagcttaagattgaagccagcttgtgtcggataaaggtgtccaaggcagcagcagacctgatgacttactgtgatgcccacgcctgtgaggatcccctcatcacccctgtgcccacttcggagaaccccttccgggagaagaagttcttctgtgctctcctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - rho/rac guanine nucleotide exchange factor (GEF) 18
- fibroblast growth factor 7 (keratinocyte growth factor)
- microtubule-associated protein 1 light chain 3 beta
- ADP-ribosylation-like factor 6 interacting protein 5

Buy GNG3-guanine nucleotide binding protein (G protein), gamma 3 Gene now

Add to cart