Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ARHGEF18-rho/rac guanine nucleotide exchange factor (GEF) 18 Gene
PTXBC008016
New product
Data sheet of ARHGEF18-rho/rac guanine nucleotide exchange factor (GEF) 18 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARHGEF18-rho/rac guanine nucleotide exchange factor (GEF) 18 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008016 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARHGEF18 |
| Origin species: | Human |
| Product name: | ARHGEF18-rho/rac guanine nucleotide exchange factor (GEF) 18 Gene |
| Size: | 2ug |
| Accessions: | BC008016 |
| Gene id: | 23370 |
| Gene description: | rho/rac guanine nucleotide exchange factor (GEF) 18 |
| Synonyms: | P114-RhoGEF; rho guanine nucleotide exchange factor 18; 114 kDa Rho-specific guanine nucleotide exchange factor; Rho-specific guanine nucleotide exchange factor p114; Rho/Rac guanine nucleotide exchange factor (GEF) 18; SA-RhoGEF; p114RhoGEF; septin-associated RhoGEF; Rho/Rac guanine nucleotide exchange factor 18 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcccagggcatgcagaggatgcacctagagacgttgcagcaagtggacaagtggccgctgtgcgggcccctcgcttgtagtgagctgttgcagcttacggtccgttccctggaggggtggaggaaggaggtgttgggcagcatcaaaggtgctgggacatcccagggtggtgagatccatccacgatccagctccggtggagaaagggcccatgtcaagccttgttctgcaccccaagcattggtggtaggactgggtcctggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fibroblast growth factor 7 (keratinocyte growth factor) - microtubule-associated protein 1 light chain 3 beta - ADP-ribosylation-like factor 6 interacting protein 5 - ADP-ribosylation-like factor 6 interacting protein 4 |