Login to display prices
Login to display prices
ARHGEF18-rho/rac guanine nucleotide exchange factor (GEF) 18 Gene View larger

ARHGEF18-rho/rac guanine nucleotide exchange factor (GEF) 18 Gene

PTXBC008016

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARHGEF18-rho/rac guanine nucleotide exchange factor (GEF) 18 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARHGEF18-rho/rac guanine nucleotide exchange factor (GEF) 18 Gene

Proteogenix catalog: PTXBC008016
Ncbi symbol: ARHGEF18
Product name: ARHGEF18-rho/rac guanine nucleotide exchange factor (GEF) 18 Gene
Size: 2ug
Accessions: BC008016
Gene id: 23370
Gene description: rho/rac guanine nucleotide exchange factor (GEF) 18
Synonyms: P114-RhoGEF; rho guanine nucleotide exchange factor 18; 114 kDa Rho-specific guanine nucleotide exchange factor; Rho-specific guanine nucleotide exchange factor p114; Rho/Rac guanine nucleotide exchange factor (GEF) 18; SA-RhoGEF; p114RhoGEF; septin-associated RhoGEF; Rho/Rac guanine nucleotide exchange factor 18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccagggcatgcagaggatgcacctagagacgttgcagcaagtggacaagtggccgctgtgcgggcccctcgcttgtagtgagctgttgcagcttacggtccgttccctggaggggtggaggaaggaggtgttgggcagcatcaaaggtgctgggacatcccagggtggtgagatccatccacgatccagctccggtggagaaagggcccatgtcaagccttgttctgcaccccaagcattggtggtaggactgggtcctggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: