Login to display prices
Login to display prices
PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene View larger

PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene

PTXBC016368

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene

Proteogenix catalog: PTXBC016368
Ncbi symbol: PSMC1
Product name: PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene
Size: 2ug
Accessions: BC016368
Gene id: 5700
Gene description: proteasome (prosome, macropain) 26S subunit, ATPase, 1
Synonyms: P26S4; p56; 26S protease regulatory subunit 4; 26S proteasome AAA-ATPase subunit RPT2; proteasome (prosome, macropain) 26S subunit, ATPase, 1; proteasome 26S ATPase subunit 1; proteasome 26S subunit, ATPase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtcaaagtcagagtggtggtcatggtcctggaggtggcaagaaggatgacaaggacaagaaaaagaaatatgaacctcctgtaccaactagagtggggaaaaagaagaagaaaacaaagggaccagatgctgccagcaaactgccactggtgacacctcacactcagtgccggttaaaattactgaagttagagagaattaaagactatcttctcatggaggaagaattcattagaaatcaggaacaaatgaaaccattagaagaaaagcaagaggaggaaagatcaaaagtggatgatctgagggggaccccgatgtcagtaggaaccttggaagagattattgatgacaatcgtgccatcgtgtctacatctgtgggctcagaacactacgtcagcattctttcatttgtagacaaggatctgctggaacctggctgctcggtcctgctcaaccacaaggtgcatgccgtgataggggtgctgatggatgacacggatcccctggtcacagtgatgaaggtagaaaaggccccccaggagacctatgcagatattggggggttggacaaccaaattcaggaaattaaggaatctgtggagcttcctctcacccatcctgaatattatgaagagatgggtataaagcctcctaagggggtcattctctatggtccacctggcacaggtaaaaccttgttagccaaagcagtagcaaaccaaacctcagccactttcttgagagtggttggctctgaacttattcagaagtacctaggtgatgggcccaaactcgtacgggaattgttccgagttgctgaagaacatgcaccgtccatcgtgtttattgatgaaattgacgccattgggacaaaaagatatgactccaattctggtggtgagagagaaattcagcgaacaatgttggaactgctgaaccagttggatggatttgattctaggggagatgtgaaagttatcatggccacaaaccgaatagaaactttggatccagcacttatcagaccaggccgcattgacaggaagattgagttccccctgcctgatgaaaagacgaagaagcgcatctttcagattcacacaagcaggatgacgctggctgatgatgtaaccctggacgacctgatcatggctaaagatgacctctctggtgctgacatcaaggcaatctgtacagaagctggtctgatggccttaagagaacgtagaatgaaagtaacaaatgaagacttcaaaaaatctaaagaaaatgttctttataagaaacaggaaggcacccctgaggggctgtatctctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: