Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene
PTXBC016368
New product
Data sheet of PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016368 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMC1 |
| Origin species: | Human |
| Product name: | PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene |
| Size: | 2ug |
| Accessions: | BC016368 |
| Gene id: | 5700 |
| Gene description: | proteasome (prosome, macropain) 26S subunit, ATPase, 1 |
| Synonyms: | P26S4; p56; 26S protease regulatory subunit 4; 26S proteasome AAA-ATPase subunit RPT2; proteasome (prosome, macropain) 26S subunit, ATPase, 1; proteasome 26S ATPase subunit 1; proteasome 26S subunit, ATPase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtcaaagtcagagtggtggtcatggtcctggaggtggcaagaaggatgacaaggacaagaaaaagaaatatgaacctcctgtaccaactagagtggggaaaaagaagaagaaaacaaagggaccagatgctgccagcaaactgccactggtgacacctcacactcagtgccggttaaaattactgaagttagagagaattaaagactatcttctcatggaggaagaattcattagaaatcaggaacaaatgaaaccattagaagaaaagcaagaggaggaaagatcaaaagtggatgatctgagggggaccccgatgtcagtaggaaccttggaagagattattgatgacaatcgtgccatcgtgtctacatctgtgggctcagaacactacgtcagcattctttcatttgtagacaaggatctgctggaacctggctgctcggtcctgctcaaccacaaggtgcatgccgtgataggggtgctgatggatgacacggatcccctggtcacagtgatgaaggtagaaaaggccccccaggagacctatgcagatattggggggttggacaaccaaattcaggaaattaaggaatctgtggagcttcctctcacccatcctgaatattatgaagagatgggtataaagcctcctaagggggtcattctctatggtccacctggcacaggtaaaaccttgttagccaaagcagtagcaaaccaaacctcagccactttcttgagagtggttggctctgaacttattcagaagtacctaggtgatgggcccaaactcgtacgggaattgttccgagttgctgaagaacatgcaccgtccatcgtgtttattgatgaaattgacgccattgggacaaaaagatatgactccaattctggtggtgagagagaaattcagcgaacaatgttggaactgctgaaccagttggatggatttgattctaggggagatgtgaaagttatcatggccacaaaccgaatagaaactttggatccagcacttatcagaccaggccgcattgacaggaagattgagttccccctgcctgatgaaaagacgaagaagcgcatctttcagattcacacaagcaggatgacgctggctgatgatgtaaccctggacgacctgatcatggctaaagatgacctctctggtgctgacatcaaggcaatctgtacagaagctggtctgatggccttaagagaacgtagaatgaaagtaacaaatgaagacttcaaaaaatctaaagaaaatgttctttataagaaacaggaaggcacccctgaggggctgtatctctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa - NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa - Bernardinelli-Seip congenital lipodystrophy 2 (seipin) - NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa |