PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene View larger

PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016368
Product type: DNA & cDNA
Ncbi symbol: PSMC1
Origin species: Human
Product name: PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene
Size: 2ug
Accessions: BC016368
Gene id: 5700
Gene description: proteasome (prosome, macropain) 26S subunit, ATPase, 1
Synonyms: P26S4; p56; 26S protease regulatory subunit 4; 26S proteasome AAA-ATPase subunit RPT2; proteasome (prosome, macropain) 26S subunit, ATPase, 1; proteasome 26S ATPase subunit 1; proteasome 26S subunit, ATPase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtcaaagtcagagtggtggtcatggtcctggaggtggcaagaaggatgacaaggacaagaaaaagaaatatgaacctcctgtaccaactagagtggggaaaaagaagaagaaaacaaagggaccagatgctgccagcaaactgccactggtgacacctcacactcagtgccggttaaaattactgaagttagagagaattaaagactatcttctcatggaggaagaattcattagaaatcaggaacaaatgaaaccattagaagaaaagcaagaggaggaaagatcaaaagtggatgatctgagggggaccccgatgtcagtaggaaccttggaagagattattgatgacaatcgtgccatcgtgtctacatctgtgggctcagaacactacgtcagcattctttcatttgtagacaaggatctgctggaacctggctgctcggtcctgctcaaccacaaggtgcatgccgtgataggggtgctgatggatgacacggatcccctggtcacagtgatgaaggtagaaaaggccccccaggagacctatgcagatattggggggttggacaaccaaattcaggaaattaaggaatctgtggagcttcctctcacccatcctgaatattatgaagagatgggtataaagcctcctaagggggtcattctctatggtccacctggcacaggtaaaaccttgttagccaaagcagtagcaaaccaaacctcagccactttcttgagagtggttggctctgaacttattcagaagtacctaggtgatgggcccaaactcgtacgggaattgttccgagttgctgaagaacatgcaccgtccatcgtgtttattgatgaaattgacgccattgggacaaaaagatatgactccaattctggtggtgagagagaaattcagcgaacaatgttggaactgctgaaccagttggatggatttgattctaggggagatgtgaaagttatcatggccacaaaccgaatagaaactttggatccagcacttatcagaccaggccgcattgacaggaagattgagttccccctgcctgatgaaaagacgaagaagcgcatctttcagattcacacaagcaggatgacgctggctgatgatgtaaccctggacgacctgatcatggctaaagatgacctctctggtgctgacatcaaggcaatctgtacagaagctggtctgatggccttaagagaacgtagaatgaaagtaacaaatgaagacttcaaaaaatctaaagaaaatgttctttataagaaacaggaaggcacccctgaggggctgtatctctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
- NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
- Bernardinelli-Seip congenital lipodystrophy 2 (seipin)
- NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa

Buy PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene now

Add to cart