RGP1-RGP1 retrograde golgi transport homolog (S. cerevisiae) Gene View larger

RGP1-RGP1 retrograde golgi transport homolog (S. cerevisiae) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RGP1-RGP1 retrograde golgi transport homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RGP1-RGP1 retrograde golgi transport homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001725
Product type: DNA & cDNA
Ncbi symbol: RGP1
Origin species: Human
Product name: RGP1-RGP1 retrograde golgi transport homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC001725
Gene id: 9827
Gene description: RGP1 retrograde golgi transport homolog (S. cerevisiae)
Synonyms: RGP1 homolog, RAB6A GEF complex partner 1; retrograde Golgi transport protein RGP1 homolog; RGP1 retrograde golgi transport homolog; KIAA0258; RAB6A-GEF complex partner protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattgaagtggtagcagagctcagccggggtcctgtatttttggctggggaggcgctggagtgtgtagtgaccgtcaccaacccccttccgcccacggccacttctgcatccagtgaggccctggcctgggccagtgcccaaatccactgccagttccatgccagtgagagtcgagtagcactgcctcctcctgactctagtcagccagatgtccagcccgacagccagactgtctttctgccacaccgaggtgagaggggccagtgtatcctttctactccaccgaaaattctattctgtgacctgaggcttgatcctggagagtccaaatcatactcctacagtgaagtgctgcccatagagggaccaccctcctttcggggtcagtcagtcaagtacgtctacaaactgaccattggctgccagcgtgtcaactcccctatcactttactcagagtccctctgagggttcttgtgctgactggccttcaggatgtccggtttccccaggatgaggctgtagccccatccagtccattcttggaggaggatgaaggtgggaagaaagattcatggctagctgagctggctggggaacgcctaatggctgccacatcctgccgcagcctccatctatacaatatcagtgatggccgagggaaagttgggacgtttggcatcttcaaatctgtgtacagacttggcgaggacgtggtggggaccttaaacttaggggaaggaaccgtagcttgtttgcagttttcagtcagcttacagaccgaggagcgtgtacagcctgagtaccagcggcgacgtggggcagggggtgtcccctctgtgtcacatgtgactcacgcccggcaccaggaatcctgcctacatacaactagaaccagcttctccctcccaatccctctcagctccaccccaggcttctgtacagccattgtgtccttgaagtggagattgcattttgaatttgtaacgtcccgagaaccaggattggtactcctaccccctgtggaacagcccgaacctaccacctggacaggacctgagcaagtacctgtagacaccttcagctgggacctgcccatcaaggtgctgcctactagccccaccctggcctcatatgctgccccaggccccagcaccagcaccataaccatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Bernardinelli-Seip congenital lipodystrophy 2 (seipin)
- proteasome (prosome, macropain) 26S subunit, ATPase, 1
- NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa
- NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa

Buy RGP1-RGP1 retrograde golgi transport homolog (S. cerevisiae) Gene now

Add to cart