Login to display prices
Login to display prices
BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene View larger

BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene

PTXBC012140

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene

Proteogenix catalog: PTXBC012140
Ncbi symbol: BSCL2
Product name: BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene
Size: 2ug
Accessions: BC012140
Gene id: 26580
Gene description: Bernardinelli-Seip congenital lipodystrophy 2 (seipin)
Synonyms: BSCL2, seipin lipid droplet biogenesis associated; GNG3LG; HMN5; PELD; SPG17; seipin; Berardinelli-Seip congenital lipodystrophy 2 (seipin); Bernardinelli-Seip congenital lipodystrophy type 2 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtcaacgaccctccagtacctgccttactgtgggcccaggaggtgggccaagtcttggcaggccgtgcccgcaggctgctgctgcagtttggggtgctcttctgcaccatcctccttttgctctgggtgtctgtcttcctctatggctccttctactattcctatatgccgacagtcagccacctcagccctgtgcatttctactacaggaccgactgtgattcctccaccacctcactctgctccttccctgttgccaatgtctcgctgactaagggtggacgtgatcgggtgctgatgtatggacagccgtatcgtgttaccttagagcttgagctgccagagtcccctgtgaatcaagatttgggcatgttcttggtcaccatttcctgctacaccagaggtggccgaatcatctccacttcttcgcgttcggtgatgctgcattaccgctcagacctgctccagatgctggacacactggtcttctctagcctcctgctatttggctttgcagagcagaagcagctgctggaggtggaactctacgcagactatagagagaactcgtacgtgccgaccactggagcgatcattgagatccacagcaagcgcatccagctgtatggagcctacctccgcatccacgcgcacttcactgggctcagatacctgctatacaacttcccgatgacctgcgccttcataggtgttgccagcaacttcaccttcctcagcgtcatcgtgctcttcagctacatgcagtgggtgtgggggggcatctggccccgacaccgcttctctttgcaggttaacatccgaaaaagagacaattcccggaaggaagtccaacgaaggatctctgctcatcagccagggcctgaaggccaggaggagtcaactccgcaatcagatgttacagaggatggtgagagccctgaagatccctcagggacagagggtcagctgtctgaggaggagaaaccagatcagcagcccctgagcggagaagaggagctagagcctgaggccagtgatggttcaggctcctgggaagatgcagctttgctgacggaggccaacctgcctgctcctgctcctgcttctgcttctgcccctgtcctagagactctgggcagctctgaacctgctgggggtgctctccgacagcgccccacctgctctagttcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: