SLC25A3-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3 Gene View larger

SLC25A3-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3 Gene

PTXBC000998

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A3-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A3-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000998
Product type: DNA & cDNA
Ncbi symbol: SLC25A3
Origin species: Human
Product name: SLC25A3-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3 Gene
Size: 2ug
Accessions: BC000998
Gene id: 5250
Gene description: solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3
Synonyms: OK/SW-cl.48; PHC; PTP; phosphate carrier protein, mitochondrial; phosphate transport protein; solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3; solute carrier family 25 member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttctcgtccgtggcgcacctggcgcgggcgaaccccttcaacacgccacatctgcagctggtgcacgatggtctcggggacctccgcagcagctccccagggcccacgggccagccccgccgccctcgcaacctggcagccgccgccgtggaagagtacagttgtgaatttggctccgcgaagtattatgcactgtgtggctttggtggggtcttaagttgtggtctgacacacactgctgtggttcccctggatttagtgaaatgccgtatgcaggtggacccccaaaagtacaagggcatatttaacggattctcagttacacttaaagaggatggtgttcgtggtttggctaaaggatgggctccgactttccttggctactccatgcagggactctgcaagtttggcttttatgaagtctttaaagtcttgtatagcaatatgcttggagaggagaatacttatctctggcgcacatcactatatttggctgcctctgccagtgctgaattctttgctgacattgccctggctcctatggaagctgctaaggttcgaattcaaacccagccaggttatgccaacactttgagggatgcagctcccaaaatgtataaggaagaaggcctaaaagcattctacaagggggttgctcctctctggatgagacagataccatacaccatgatgaagttcgcctgctttgaacgtactgttgaagcactgtacaagtttgtggttcctaagccccgcagtgaatgttcaaagccagagcagctggttgtaacatttgtagcaggttacatagctggagtcttttgtgcaattgtttctcaccctgctgattctgtggtatctgtgttgaataaagaaaaaggtagcagtgcttctctggtcctcaagagacttggatttaaaggtgtatggaagggactgtttgcccgtatcatcatgattggtaccctgactgcactacagtggtttatctatgactccgtgaaggtctacttcagacttcctcgccctcctccacccgagatgccagagtctctgaagaagaagcttgggttaactcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
- leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2
- pleckstrin homology domain containing, family G (with RhoGef domain) member 2
- v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian)

Buy SLC25A3-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3 Gene now

Add to cart