Login to display prices
Login to display prices
MYCL1-v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) Gene View larger

MYCL1-v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) Gene

PTXBC011864

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MYCL1-v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MYCL1-v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) Gene

Proteogenix catalog: PTXBC011864
Ncbi symbol: MYCL1
Product name: MYCL1-v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) Gene
Size: 2ug
Accessions: BC011864
Gene id: 4610
Gene description: v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian)
Synonyms: MYCL1; L-Myc; LMYC; bHLHe38; protein L-Myc; class E basic helix-loop-helix protein 38; l-myc-1 proto-oncogene; myc-related gene from lung cancer; protein L-Myc-1; v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived; v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactacgactcgtaccagcactatttctacgactatgactgcggggaggatttctaccgctccacggcgcccagcgaggacatctggaagaaattcgagctggtgccatcgccccccacgtcgccgccctggggcttgggtcccggcgcaggggacccggcccccgggattggtcccccggagccgtggcccggagggtgcaccggagacgaagcggaatcccggggccactcgaaaggctggggcaggaactacgcctccatcatacgccgtgactgcatgtggagcggcttctcggcccgggaacggctggagagagctgtgagcgaccggctcgctcctggcgcgccccgggggaacccgcccaaggcgtccgccgccccggactgcactcccagcctcgaagccggcaacccggcgcccgccgccccctgtccgctgggcgaacccaagacccaggcctgctccgggtccgagagcccaagcgactcgggtaaggacctccccgagccatccaagagggggccaccccatgggtggccaaagctctgcccctgcctgaggtcaggcattggctcttctcaagctcttgggccatctccgcctctctttggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: