Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SIRT2-sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae) Gene
PTXBC003012
New product
Data sheet of SIRT2-sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SIRT2-sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003012 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SIRT2 |
| Origin species: | Human |
| Product name: | SIRT2-sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC003012 |
| Gene id: | 22933 |
| Gene description: | sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae) |
| Synonyms: | SIR2; SIR2L; SIR2L2; NAD-dependent protein deacetylase sirtuin-2; NAD-dependent deacetylase sirtuin-2; SIR2-like protein 2; regulatory protein SIR2 homolog 2; silent information regulator 2; sir2-related protein type 2; sirtuin type 2; sirtuin 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacttcctgcggaacttattctcccagacgctcagcctgggcagccagaaggagcgtctgctggacgagctgaccttggaaggggtggcccggtacatgcagagcgaacgctgtcgcagagtcatctgtttggtgggagctggaatctccacatccgcaggcatccccgactttcgctctccatccaccggcctctatgacaacctagagaagtaccatcttccctacccagaggccatctttgagatcagctatttcaagaaacatccggaacccttcttcgccctcgccaaggaactctatcctgggcagttcaagccaaccatctgtcactacttcatgcgcctgctgaaggacaaggggctactcctgcgctgctacacgcagaacatagataccctggagcgaatagccgggctggaacaggaggacttggtggaggcgcacggcaccttctacacatcacactgcgtcagcgccagctgccggcacgaatacccgctaagctggatgaaagagaagatcttctctgaggtgacgcccaagtgtgaagactgtcagagcctggtgaagcctgatatcgtcttttttggtgagagcctcccagcgcgtttcttctcctgtatgcagtcagacttcctgaaggtggacctcctcctggtcatgggtacctccttgcaggtgcagccctttgcctccctcatcagcaaggcacccctctccacccctcgcctgctcatcaacaaggagaaagctggccagtcggaccctttcctggggatgattatgggcctcggaggaggcatggactttgactccaagaaggcctacagggacgtggcctggctgggtgaatgcgaccagggctgcctggcccttgctgagctccttggatggaagaaggagctggaggaccttgtccggagggagcacgccagcatagatgcccagtcgggggcgggggtccccaaccccagcacttcagcttcccccaagaagtccccgccacctgccaaggacgaggccaggacaacagagagggagaaaccccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 - elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 - cell division cycle 2-like 5 (cholinesterase-related cell division controller) - apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative) |