No products
Prices are tax excluded
PTXBC034344
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034344 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ELOVL3 |
| Origin species: | Human |
| Product name: | ELOVL3-elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 Gene |
| Size: | 2ug |
| Accessions: | BC034344 |
| Gene id: | 83401 |
| Gene description: | elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 |
| Synonyms: | 3-keto acyl-CoA synthase ELOVL3; CIG-30; CIG30; elongation of very long chain fatty acids protein 3; ELOVL FA elongase 3; cold-inducible glycoprotein of 30 kDa; elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3; very long chain 3-ketoacyl-CoA synthase 3; very long chain 3-oxoacyl-CoA synthase 3; ELOVL fatty acid elongase 3 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtcacagccatgaatgtctcacatgaagtaaatcagctgttccagccctataacttcgagctgtccaaggacatgaggccctttttcgaggagtattgggcaacctcattccccatagccctgatctacctggttctcatcgctgtggggcagaactacatgaaggaacgcaagggcttcaacctgcaagggcctctcatcctctggtccttctgccttgcaatcttcagtatcctgggggcagtgaggatgtggggcattatggggactgtgctacttaccgggggcctaaagcaaaccgtgtgcttcatcaacttcatcgataattccacagtcaaattctggtcctgggtctttcttctcagcaaggtcatagaactcggagacacagccttcatcatcctgcgtaagcggccactcatctttattcactggtaccaccacagcacagtgctcgtgtacacaagctttggatacaagaacaaagtgcctgcaggaggctggttcgtcaccatgaactttggtgttcatgccatcatgtacacctactacactctgaaggctgccaacgtgaagccccccaagatgctgcccatgctcatcaccagcctgcagatcttgcagatgtttgtaggagccatcgtcagcatcctcacgtacatctggaggcaggatcagggatgccacaccacgatggaacacttattctggtccttcatcttgtatatgacctatttcatcctctttgcccacttcttctgccagacctacatcaggcccaaggtcaaagccaagaccaagagccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 - cell division cycle 2-like 5 (cholinesterase-related cell division controller) - apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative) - sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae) |