ELOVL4-elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 Gene View larger

ELOVL4-elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ELOVL4-elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ELOVL4-elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC038506
Product type: DNA & cDNA
Ncbi symbol: ELOVL4
Origin species: Human
Product name: ELOVL4-elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 Gene
Size: 2ug
Accessions: BC038506
Gene id: 6785
Gene description: elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4
Synonyms: 3-keto acyl-CoA synthase ELOVL4; ADMD; CT118; ISQMR; SCA34; STGD2; STGD3; elongation of very long chain fatty acids protein 4; ELOVL FA elongase 4; cancer/testis antigen 118; elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4; very long chain 3-ketoacyl-CoA synthase 4; very long chain 3-oxoacyl-CoA synthase 4; ELOVL fatty acid elongase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggctcctggactcggagccgggtagtgtcctaaacgtagtgtccacggcactcaacgacacggtagagttctaccgctggacctggtccatcgcagataagcgtgtggaaaattggcctctgatgcggtctccttggcctacactaagtataagcactctttatctcctgtttgtgtggctgggtccaaaatggatgaaggaccgagaaccttttcagatgcgtctagtgctcattatctataattttgggatggttttgcttaacctctttatcttcagagagttattcatgggatcatataatgcgggatatagctatatttgccagagtgtggattattctaataatgttcatgaagtcaggatagctgctgctctgtggtggtactttgtatctaaaggagttgagtatttggacacagtgttttttattctgagaaagaaaaacaaccaagtttctttccttcatgtgtatcatcactgtacgatgtttaccttgtggtggattggaattaagtgggttgcaggaggacaagcattttttggagcccagttgaattcctttatccatgtgattatgtactcatactatgggttaactgcatttggcccatggattcagaaatatctttggtggaaacgatacctgactatgttgcaactgattcaattccatgtgaccattgggcacacagcactgtctctttacactgactgccccttccccaaatggatgcactgggctctaattgcctatgcaatcagcttcatatttctctttcttaacttctacattcggacatacaaagagcctaagaaaccaaaagctggaaaaacagccatgaatggtatttcagcaaatggtgtgagcaaatcagaaaaacaactcatgatagaaaatggaaaaaagcagaaaaatggaaaagcaaaaggagattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cell division cycle 2-like 5 (cholinesterase-related cell division controller)
- apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
- sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae)
- 1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)

Buy ELOVL4-elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 Gene now

Add to cart