Login to display prices
Login to display prices
SIRT7-sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae) Gene View larger

SIRT7-sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae) Gene

PTXBC017305

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SIRT7-sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SIRT7-sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae) Gene

Proteogenix catalog: PTXBC017305
Ncbi symbol: SIRT7
Product name: SIRT7-sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae) Gene
Size: 2ug
Accessions: BC017305
Gene id: 51547
Gene description: sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae)
Synonyms: SIR2L7; NAD-dependent protein deacetylase sirtuin-7; NAD-dependent deacetylase sirtuin-7; SIR2-like protein 7; regulatory protein SIR2 homolog 7; silent mating type information regulation 2, S.cerevisiae, homolog 7; sir2-related protein type 7; sirtuin type 7; sirtuin 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagccgggggtctgagccgctccgagcgcaaagcggcggagcgggtccggaggttgcgggaggagcagcagagggagcgcctccgccaggtgtcgcgcatcctgaggaaggcggcggcggagcgcagcgccgaggagggccggctgctggccgagagcgcggacctggtaacggagctgcagggccggagccggcggcgcgagggcctgaagcggcggcaggaggaggtgtgcgacgacccggaggagctgcgggggaaggtccgggagctggccagcgccgtccggaacgccaaatacttggtcgtctacacaggcgcgggaatcagcacggcagcgtctatcccagactaccggggccctaatggagtgtggacactgcttcagaaagggagaagcgttagtgctgccgacctgagcgaggccgagccaaccctcacccacatgagcatcacccgtctgcatgagcagaagctggtgcagcatgtggtgtctcagaactgtgacgggctccacctgaggagtgggctgccgcgcacggccatctccgagctccacgggaacatgtacattgaagtctgtacctcctgcgttcccaacagggagtacgtgcgggtgttcgatgtgacggagcgcactgccctccacagacaccagacaggccggacctgccacaagtgtgggacccagctgcgggacaccattgtgcactttggggagagggggacgttggggcagcctctgaactgggaagcggcgaccgaggctgccagcagagcagacaccatcctgtgtctagggtccagcctgaaggttctaaagaagtacccacgcctctggtgcatgaccaagccccctagccggcggccgaagctttacatcgtgaacctgcagtggaccccgaaggatgactgggctgccctgaagctacatgggaagtgtgatgacgtcatgcggctcctcatggccgagctgggcttggagatccccgcctatagcaggtggcaggatcccattttctcactggcgactcccctgcgtgctggtgaagaaggcagccacagtcggaagtcgctgtgcagaagcagagaggaggccccgcctggggaccggggtgcaccgcttagctcggcccccatcctagggggctggtttggcaggggctgcacaaaacgcacaaaaaggaagaaagtgacgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: