SLC7A3-solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 Gene View larger

SLC7A3-solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 Gene

PTXBC033816

New product

Data sheet of SLC7A3-solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC7A3-solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC033816
Product type: DNA & cDNA
Ncbi symbol: SLC7A3
Origin species: Human
Product name: SLC7A3-solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 Gene
Size: 2ug
Accessions: BC033816
Gene id: 84889
Gene description: solute carrier family 7 (cationic amino acid transporter, y+ system), member 3
Synonyms: ATRC3; CAT-3; CAT3; cationic amino acid transporter 3; solute carrier family 7 (cationic amino acid transporter, y+ system), member 3; solute carrier family 7 member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgtggcaagcatttcgcagatttggtcaaaagctggtacgcagacgtacactggagtcaggcatggctgagactcgccttgccagatgcctaagcaccctggatttagtggccctgggtgtgggcagcacattgggtgcaggcgtgtatgtcctagctggcgaggtggccaaagataaagcagggccatccattgtgatctgctttttggtggctgccctgtcttctgtgttggctgggctgtgctatgcggagtttggtgcccgggttccccgttctggttcggcatatctctacagctatgtcactgtgggtgaactctgggccttcaccactggctggaacctcatcctctcctatgtcattggtacagccagtgtggcccgggcctggagctctgcttttgacaacctgattgggaaccacatctctaagactctgcaggggtccattgcactgcacgtgccccatgtccttgcagaatatccagatttctttgctttgggcctcgtgttgctgctcactggattgttggctctcggggctagtgagtcggccctggttaccagagtgttcacaggcgtgaaccttttggttcttgggttcgtcatgatctctggcttcgttaagggggacgtgcacaactggaagctcacagaagaggactacgaattggccatggctgaactcaatgacacctatagcttgggtcctctgggctctggaggatttgtgcctttcggcttcgagggaattctccgtggagcagcgacctgtttctatgcatttgttggtttcgactgtattgctaccactggagaagaagcccagaatccccagcgttccatcccgatgggcattgtgatctcactgtctgtctgctttttggcgtattttgctgtctcttctgcactcaccctgatgatgccttactaccagcttcagcctgagagccctttgcctgaggcatttctctacattggatgggctcctgcccgctatgttgtggctgttggctccctctgtgctctttctaccagcctcctgggctccatgttccccatgcctcgggtgatctacgcgatggcagaggatggcctcctgttccgtgtacttgctcggatccacaccggcacacgcaccccaatcatagccaccgtggtctctggcattattgcagcattcatggcattcctcttcaaactcactgatcttgtggacctcatgtcaattgggaccctgcttgcttactccctggtgtcgatttgtgttctcatcctcaggtatcaacctgatcaggagacaaagactggggaagaagtggagttgcaggaggaggcaataactactgaatcagagaagttgaccctatggggactatttttcccactcaactccatccccactccactctctggccaaattgtctatgtttgttcctcattgcttgctgtcctgctgactgctctttgcctggtgctggcccagtggtcagttccattgctttctggagacctggtgtggactgcagtggttgtgctgctcctgctgctcattattgggatcattgtggtcatctggagacagccacagagctccactccccttcactttaaggtgcctgctttgcctctcctcccactaatgagcatctttgtgaatatttaccttatgatgcagatgacagctggtacctgggcccgatttggggtctggatgctgattggctttgctatctacttcggctatgggatccagcacagcctggaagagattaagagtaaccaaccctcacgcaagtctagagccaaaactgtagaccttgatcccggcactctctatgtccactcagtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1
- SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
- SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1
- SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3

Buy SLC7A3-solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 Gene now

Add to cart