Cart 49 Product Products 9 099,22 € (empty)
-
1 x ZNF174-zin...113,40 € -
-
-
1 x TESC-tesca...113,40 € -
1 x SH3BGR-SH3...113,40 € -
1 x WBP2NL-WBP...121,50 € -
1 x HIST2H3A-h...113,40 € -
1 x MIP-3β...259,07 € -
-
-
1 x KLF15-Krup...121,50 € -
1 x ZNF215-zin...121,50 € -
1 x C18orf25-c...121,50 € -
1 x ZIK1-zinc...121,50 € -
1 x SLAMF8-SLA...121,50 € -
1 x LOC145757-...113,40 € -
-
-
-
1 x TCN2-trans...121,50 € -
1 x CCDC130-co...121,50 € -
1 x DBI-diazep...113,40 € -
1 x C19orf12-c...113,40 € -
1 x ZMAT2-zinc...113,40 € -
1 x SPRR2A-sma...113,40 € -
-
1 x C2orf49-ch...113,40 € -
1 x LZIC-leuci...113,40 € -
1 x PYHIN1-pyr...113,40 € -
1 x RBPJ-recom...121,50 € -
1 x SLC15A3-so...121,50 € -
-
-
1 x THUMPD2-TH...121,50 € -
1 x SLC47A1-so...121,50 € -
1 x TTC31-tetr...121,50 € -
-
-
-
1 x GMPPB-GDP-...121,50 € -
1 x PXMP3-pero...121,50 € -
1 x PALM-paral...121,50 € -
1 x PUF60-poly...121,50 € -
1 x C8orf22-ch...113,40 € -
1 x PVRIG-poli...121,50 € -
-
1 x GTF2H2-gen...113,40 € -
1 x C11orf53-c...113,40 € -
1 x TBC1D3C-TB...121,50 €
No products
To be determined Shipping
9 099,22 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 49 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 9 099,22 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 9 099,22 €
View larger 
SLC7A3-solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 Gene
PTXBC033816
New product
Data sheet of SLC7A3-solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC7A3-solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC033816 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC7A3 |
| Origin species: | Human |
| Product name: | SLC7A3-solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 Gene |
| Size: | 2ug |
| Accessions: | BC033816 |
| Gene id: | 84889 |
| Gene description: | solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 |
| Synonyms: | ATRC3; CAT-3; CAT3; cationic amino acid transporter 3; solute carrier family 7 (cationic amino acid transporter, y+ system), member 3; solute carrier family 7 member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgtggcaagcatttcgcagatttggtcaaaagctggtacgcagacgtacactggagtcaggcatggctgagactcgccttgccagatgcctaagcaccctggatttagtggccctgggtgtgggcagcacattgggtgcaggcgtgtatgtcctagctggcgaggtggccaaagataaagcagggccatccattgtgatctgctttttggtggctgccctgtcttctgtgttggctgggctgtgctatgcggagtttggtgcccgggttccccgttctggttcggcatatctctacagctatgtcactgtgggtgaactctgggccttcaccactggctggaacctcatcctctcctatgtcattggtacagccagtgtggcccgggcctggagctctgcttttgacaacctgattgggaaccacatctctaagactctgcaggggtccattgcactgcacgtgccccatgtccttgcagaatatccagatttctttgctttgggcctcgtgttgctgctcactggattgttggctctcggggctagtgagtcggccctggttaccagagtgttcacaggcgtgaaccttttggttcttgggttcgtcatgatctctggcttcgttaagggggacgtgcacaactggaagctcacagaagaggactacgaattggccatggctgaactcaatgacacctatagcttgggtcctctgggctctggaggatttgtgcctttcggcttcgagggaattctccgtggagcagcgacctgtttctatgcatttgttggtttcgactgtattgctaccactggagaagaagcccagaatccccagcgttccatcccgatgggcattgtgatctcactgtctgtctgctttttggcgtattttgctgtctcttctgcactcaccctgatgatgccttactaccagcttcagcctgagagccctttgcctgaggcatttctctacattggatgggctcctgcccgctatgttgtggctgttggctccctctgtgctctttctaccagcctcctgggctccatgttccccatgcctcgggtgatctacgcgatggcagaggatggcctcctgttccgtgtacttgctcggatccacaccggcacacgcaccccaatcatagccaccgtggtctctggcattattgcagcattcatggcattcctcttcaaactcactgatcttgtggacctcatgtcaattgggaccctgcttgcttactccctggtgtcgatttgtgttctcatcctcaggtatcaacctgatcaggagacaaagactggggaagaagtggagttgcaggaggaggcaataactactgaatcagagaagttgaccctatggggactatttttcccactcaactccatccccactccactctctggccaaattgtctatgtttgttcctcattgcttgctgtcctgctgactgctctttgcctggtgctggcccagtggtcagttccattgctttctggagacctggtgtggactgcagtggttgtgctgctcctgctgctcattattgggatcattgtggtcatctggagacagccacagagctccactccccttcactttaaggtgcctgctttgcctctcctcccactaatgagcatctttgtgaatatttaccttatgatgcagatgacagctggtacctgggcccgatttggggtctggatgctgattggctttgctatctacttcggctatgggatccagcacagcctggaagagattaagagtaaccaaccctcacgcaagtctagagccaaaactgtagaccttgatcccggcactctctatgtccactcagtttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 |