Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SMARCD3-SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 Gene
PTXBC002628
New product
Data sheet of SMARCD3-SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SMARCD3-SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002628 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SMARCD3 |
| Origin species: | Human |
| Product name: | SMARCD3-SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC002628 |
| Gene id: | 6604 |
| Gene description: | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 |
| Synonyms: | BAF60C; CRACD3; Rsc6p; SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily D member 3; 60 kDa BRG-1/Brm-associated factor subunit C; BRG1-associated factor 60C; SWI/SNF complex 60 kDa subunit C; Swp73-like protein; chromatin remodeling complex BAF60C subunit; mammalian chromatin remodeling complex BRG1-associated factor 60C; SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactccaggtcttcagcacccacccaccgtggtacagcgccccgggatgccgtctggagcccggatgccccaccagggggcgcccatgggccccccgggctccccgtacatgggcagccccgccgtgcgacccggcctggcccccgcgggcatggagcccgcccgcaagcgagcagcgcccccgcccgggcagagccaggcacagagccagggccagccggtgcccaccgcccccgcgcggagccgcagtgccaagaggaggaagatggctgacaaaatcctccctcaaaggattcgggagctggtccccgagtcccaggcttacatggacctcttggcatttgagaggaaactggatcaaaccatcatgcggaagcgggtggacatccaggaggctctgaagaggcccatgaagcaaaagcggaagctgcgactctatatctccaacacttttaaccctgcgaagcctgatgctgaggattccgacggcagcattgcctcctgggagctacgggtggaggggaagctcctggatgatcccagcaaacagaagcggaagttctcttctttcttcaagagtttggtcatcgagctggacaaagatctttatggccctgacaaccacctcgttgagtggcatcggacacccacgacccaggagacggacggcttccaggtgaaacggcctggggacctgagtgtgcgctgcacgctgctcctcatgctggactaccagcctccccagttcaaactggatccccgcctagcccggctgctggggctgcacacacagagccgctcagccattgtccaggccctgtggcagtatgtgaagaccaacaggctgcaggactcccatgacaaggaatacatcaatggggacaagtatttccagcagatttttgattgtccccggctgaagttttctgagattccccagcgcctcacagccctgctattgccccctgacccaattgtcatcaaccatgtcatcagcgtggacccttcagaccagaagaagacggcgtgctatgacattgacgtggaggtggaggagccattaaaggggcagatgagcagcttcctcctatccacggccaaccagcaggagatcagtgctctggacagtaagatccatgagacgattgagtccataaaccagctcaagatccagagggacttcatgctaagcttctccagagaccccaaaggctatgtccaagacctgctccgctcccagagccgggacctcaaggtgatgacagatgtagccggcaaccctgaagaggagcgccgggctgagttctaccaccagccctggtcccaggaggccgtcagtcgctacttctactgcaagatccagcagcgcaggcaggagctggagcagtcgctggttgtgcgcaacacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 - chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) - DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) |