Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SMARCB1-SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 Gene
PTXBC117114
New product
Data sheet of SMARCB1-SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SMARCB1-SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC117114 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SMARCB1 |
| Origin species: | Human |
| Product name: | SMARCB1-SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC117114 |
| Gene id: | 6598 |
| Gene description: | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 |
| Synonyms: | BAF47; CSS3; MRD15; PPP1R144; RDT; RTPS1; SNF5; SNF5L1; SWNTS1; Sfh1p; Snr1; hSNFS; SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1; BRG1-associated factor 47; SNF5 homolog; SWI/SNF-related matrix-associated protein; hSNF5; integrase interactor 1 protein; malignant rhabdoid tumor suppressor; protein phosphatase 1, regulatory subunit 144; sucrose nonfermenting, yeast, homolog-like 1; SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgatgatggcgctgagcaagaccttcgggcagaagcccgtgaagttccagctggaggacgacggcgagttctacatgatcggctccgaggtgggaaactacctccgtatgttccgaggttctctgtacaagagatacccctcactctggaggcgactagccactgtggaagagaggaagaaaatagttgcatcgtcacatgatcacggatacacgactctagccaccagtgtgaccctgttaaaagcctcggaagtggaagagattctggatggcaacgatgagaagtacaaggctgtgtccatcagcacagagccccccacctacctcagggaacagaaggccaagaggaacagccagtgggtacccaccctgcccaacagctcccaccacttagatgccgtgccatgctccacaaccatcaacaggaaccgcatgggccgagacaagaagagaaccttccccctttgctttgatgaccatgacccagctgtgatccatgagaacgcatctcagcccgaggtgctggtccccatccggctggacatggagatcgatgggcagaagctgcgagacgccttcacctggaacatgaatgagaagttgatgacgcctgagatgttttcagaaatcctctgtgacgatctggatttgaacccgctgacgtttgtgccagccatcgcctctgccatcagacagcagatcgagtcctaccccacggacagcatcctggaggaccagtcagaccagcgcgtcatcatcaagctgaacatccatgtgggaaacatttccctggtggaccagtttgagtgggacatgtcagagaaggagaactcaccagagaagtttgccctgaagctgtgctcggagctggggttgggcggggagtttgtcaccaccatcgcatacagcatccggggacagctgagctggcatcagaagacctacgccttcagcgagaaccctctgcccacagtggagattgccatccggaacacgggcgatgcggaccagtggtgcccactgctggagactctgacagacgctgagatggagaagaagatccgcgaccaggacaggaacacgaggcggatgaggcgtcttgccaacacggccccggcctggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) - DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) - TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa - sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) |